Busch Lab

ZMP

sh2b1

Ensembl ID:
ENSDARG00000057679
ZFIN ID:
ZDB-GENE-070209-188
Description:
SH2B adapter protein 1 [Source:RefSeq peptide;Acc:NP_001103925]
Human Orthologue:
SH2B1
Human Description:
SH2B adaptor protein 1 [Source:HGNC Symbol;Acc:30417]
Mouse Orthologue:
Sh2b1
Mouse Description:
SH2B adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201407]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13668 Nonsense Available for shipment Available now
sa33116 Nonsense Mutation detected in F1 DNA Not yet available
sa17429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083976 Nonsense 34 906 1 8
ENSDART00000141808 Nonsense 34 906 3 10
ENSDART00000143280 Nonsense 34 109 2 2
Genomic Location (Zv9):
Chromosome 3 (position 14965745)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15211351
GRCz11 3 15361151
KASP Assay ID:
2259-3176.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTCCCCTTCCGCCATCCCCTTCTCCAKCGCCCTCTCCTCCGTCTCCAT[C/A]GCTGTTGCCCTTGTCCACCAGACCTCCGCCTTTGCCTCCTCCGACTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083976 Nonsense 336 906 1 8
ENSDART00000141808 Nonsense 336 906 3 10
ENSDART00000143280 None None 109 None 2
Genomic Location (Zv9):
Chromosome 3 (position 14966652)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15212258
GRCz11 3 15362058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGGCATCTTGCATTGGCGCAGCTCCTCCAGCGACTCCCCGCAGAACTG[C/A]AGCAACTCCAGCCCTCTTCCCTCCAGCTACAGCTACACTACTGGCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17429
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083976 Nonsense 528 906 1 8
ENSDART00000141808 Nonsense 528 906 3 10
ENSDART00000143280 None None 109 None 2
Genomic Location (Zv9):
Chromosome 3 (position 14967226)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15212832
GRCz11 3 15362632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGTGGACGGGGTACGCGTTGGCAYAAGTGCCGTCTAGTTYTGAAAGAA[C/T]GAGATAAGGATGGAGGGGATGGAGGGTTGGAATATTTCCTGGAGTTTTAC
Associated Phenotype:
Not determined