Busch Lab

ZMP

epas1b

Ensembl ID:
ENSDARG00000057671
ZFIN ID:
ZDB-GENE-060607-11
Description:
endothelial PAS domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001034895]
Human Orthologue:
EPAS1
Human Description:
endothelial PAS domain protein 1 [Source:HGNC Symbol;Acc:3374]
Mouse Orthologue:
Epas1
Mouse Description:
endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa814 Nonsense Available for shipment Available now
sa35421 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6284
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080382 Essential Splice Site 73 834 2 16
ENSDART00000123836 Essential Splice Site 72 833 3 17
Genomic Location (Zv9):
Chromosome 13 (position 7779412)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8083932
GRCz11 13 8415955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAGACTGGCTATCAGCTTCCTGCGGACACGCAAACTYGTCAMCTCAGG[T/C]ACACAGTCAKTATATGACAAWTATTAAYTCAAACCMGCTTTATTATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa814
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080382 Nonsense 654 834 12 16
ENSDART00000123836 Nonsense 653 833 13 17
Genomic Location (Zv9):
Chromosome 13 (position 7749270)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8053790
GRCz11 13 8385813
KASP Assay ID:
554-0718.1 (used for ordering genotyping assays)
KASP Sequence:
TACCCAGCAAGGCTGGAATGATGGATCCTTTAGCTGCAAAGCGCTCTTGC[C/T]AAGGCATGCCAGCAAATCGAATGGCACCTTTTATGCAAAGGTAAGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35421
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080382 Essential Splice Site 667 834 12 16
ENSDART00000123836 Essential Splice Site 666 833 13 17
Genomic Location (Zv9):
Chromosome 13 (position 7749229)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8053749
GRCz11 13 8385772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTCTTGCCAAGGCATGCCAGCAAATCGAATGGCACCTTTTATGCAAAG[G/A]TAAGTGTGCATGTTACTTGGTGTTAGTTTTGGTTCATTGTTCAGTTTAAA
Associated Phenotype:
Not determined