Busch Lab

ZMP

si:dkeyp-69b9.5

Ensembl ID:
ENSDARG00000057652
ZFIN ID:
ZDB-GENE-100922-6
Description:
D-box binding protein 2 [Source:RefSeq peptide;Acc:NP_001183991]
Human Orthologue:
DBP
Human Description:
D site of albumin promoter (albumin D-box) binding protein [Source:HGNC Symbol;Acc:2697]
Mouse Orthologue:
Dbp
Mouse Description:
D site albumin promoter binding protein Gene [Source:MGI Symbol;Acc:MGI:94866]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa22782 Nonsense Available for shipment Available now
sa663 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5619
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080372 Nonsense 120 374 2 4
ENSDART00000139102 Nonsense 120 374 3 5
ENSDART00000080372 Nonsense 120 374 2 4
ENSDART00000139102 Nonsense 120 374 3 5
Genomic Location (Zv9):
Chromosome 16 (position 15362353)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13720812
GRCz11 16 13610932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAACAACAGCAACAAYAACAACTCCTTCCTGGGCCCGTTGCTATGGGAA[C/T]GAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTGCAGTACATGGATCTY
Long Flanking Sequence:
CAGTGTAACAACATTGTAATCGCTTTACCATGGACTTTCAGACACATTAATCTTTTGCAAGTTTAAAGGAAGGTATTTCAAAGCCTCTTCATTTTGCATTGATGCACTGGGAGGCGCATCTATTCACATGTGTTGACATTGCAAAGGTAGCTCTCCCAGAGGGATGTGAAAGTTGCTGGGAACTGTTATTCCGCCCCTAACTGCGTAATCTCACAAACATTGCACTCCTGAAATGTAGAAATGTCATTATAAGTGTTAATTAGTAGTTGGCATGTTTTTTTTTTGATGGCTTAGTATATATACCCAGATTAAATTGGATGTATTTTGTTTCTCTCACAGGTAAGGAAAGGTTAGATATCGATGAGGACTCTCTCGGCCGTTGTCCTCTGCGCAACGGCTGCAGCAATGGACTAGTCACTGACAGCAATGGAGCAGGAACGGGCAGCTTCTCAAACAACAGCAACAATAACAACTCCTTCCTGGGCCCGTTGCTATGGGAA[C/T]GAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTGCAGTACATGGATCTCGAGGAGTTCCTGACGGAGAACGGGATGAGCAGCATGCACAATACCTCCAACTCCACCTCGGCTCAGATACCCTCGCAAAGCTCTCAGTCCGCCGTTCCCAACCAGGGCTCCCAGTGCCTCCCCACATCACCACCACACTGCTCCTCTTCCTCGTCACCAACATCCGCCACTGCCTCTTCACCTTCACTGCTCGGGCTGGACATGCACACGCCCCAGAGCATGATGGGATCTACAGACTGCTTGCATGGTGAGTTAGGCCCCCATTTCTACCAATCTACATTCATTTTCAGGTATACACTCACAAGCAAGATGCATTATGGTTTTCACTTGGTTTTCCACCACCTCTTGAGACTCCCTGTGTTTGGATTTCGTCAAGAATCCTCCATCTTATTTGGACACATTCTACATCAGGTTAATAGTAGTTCGATATGCAGTGTACAACCAATGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3949
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080372 Nonsense 120 374 2 4
ENSDART00000139102 Nonsense 120 374 3 5
ENSDART00000080372 Nonsense 120 374 2 4
ENSDART00000139102 Nonsense 120 374 3 5
Genomic Location (Zv9):
Chromosome 16 (position 15362353)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13720812
GRCz11 16 13610932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAACAACAGCAACAAYAACAACTCCTTCCTGGGCCCGTTGCTATGGGAA[C/T]GAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTGCAGTACATGGATCTY
Long Flanking Sequence:
CAGTGTAACAACATTGTAATCGCTTTACCATGGACTTTCAGACACATTAATCTTTTGCAAGTTTAAAGGAAGGTATTTCAAAGCCTCTTCATTTTGCATTGATGCACTGGGAGGCGCATCTATTCACATGTGTTGACATTGCAAAGGTAGCTCTCCCAGAGGGATGTGAAAGTTGCTGGGAACTGTTATTCCGCCCCTAACTGCGTAATCTCACAAACATTGCACTCCTGAAATGTAGAAATGTCATTATAAGTGTTAATTAGTAGTTGGCATGTTTTTTTTTTGATGGCTTAGTATATATACCCAGATTAAATTGGATGTATTTTGTTTCTCTCACAGGTAAGGAAAGGTTAGATATCGATGAGGACTCTCTCGGCCGTTGTCCTCTGCGCAACGGCTGCAGCAATGGACTAGTCACTGACAGCAATGGAGCAGGAACGGGCAGCTTCTCAAACAACAGCAACAATAACAACTCCTTCCTGGGCCCGTTGCTATGGGAA[C/T]GAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTGCAGTACATGGATCTCGAGGAGTTCCTGACGGAGAACGGGATGAGCAGCATGCACAATACCTCCAACTCCACCTCGGCTCAGATACCCTCGCAAAGCTCTCAGTCCGCCGTTCCCAACCAGGGCTCCCAGTGCCTCCCCACATCACCACCACACTGCTCCTCTTCCTCGTCACCAACATCCGCCACTGCCTCTTCACCTTCACTGCTCGGGCTGGACATGCACACGCCCCAGAGCATGATGGGATCTACAGACTGCTTGCATGGTGAGTTAGGCCCCCATTTCTACCAATCTACATTCATTTTCAGGTATACACTCACAAGCAAGATGCATTATGGTTTTCACTTGGTTTTCCACCACCTCTTGAGACTCCCTGTGTTTGGATTTCGTCAAGAATCCTCCATCTTATTTGGACACATTCTACATCAGGTTAATAGTAGTTCGATATGCAGTGTACAACCAATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22782
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080372 Nonsense 132 374 2 4
ENSDART00000139102 Nonsense 132 374 3 5
Genomic Location (Zv9):
Chromosome 16 (position 15362317)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13720776
GRCz11 16 13610896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTTGCTATGGGAACGAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTG[C/T]AGTACATGGATCTCGAGGAGTTCCTGACGGAGAACGGGATGAGCAGCATG
Long Flanking Sequence:
TTCAGACACATTAATCTTTTGCAAGTTTAAAGGAAGGTATTTCAAAGCCTCTTCATTTTGCATTGATGCACTGGGAGGCGCATCTATTCACATGTGTTGACATTGCAAAGGTAGCTCTCCCAGAGGGATGTGAAAGTTGCTGGGAACTGTTATTCCGCCCCTAACTGCGTAATCTCACAAACATTGCACTCCTGAAATGTAGAAATGTCATTATAAGTGTTAATTAGTAGTTGGCATGTTTTTTTTTTGATGGCTTAGTATATATACCCAGATTAAATTGGATGTATTTTGTTTCTCTCACAGGTAAGGAAAGGTTAGATATCGATGAGGACTCTCTCGGCCGTTGTCCTCTGCGCAACGGCTGCAGCAATGGACTAGTCACTGACAGCAATGGAGCAGGAACGGGCAGCTTCTCAAACAACAGCAACAATAACAACTCCTTCCTGGGCCCGTTGCTATGGGAACGAACATTGCCCTGTGATGGCGGGCTGTTTCAGTTG[C/T]AGTACATGGATCTCGAGGAGTTCCTGACGGAGAACGGGATGAGCAGCATGCACAATACCTCCAACTCCACCTCGGCTCAGATACCCTCGCAAAGCTCTCAGTCCGCCGTTCCCAACCAGGGCTCCCAGTGCCTCCCCACATCACCACCACACTGCTCCTCTTCCTCGTCACCAACATCCGCCACTGCCTCTTCACCTTCACTGCTCGGGCTGGACATGCACACGCCCCAGAGCATGATGGGATCTACAGACTGCTTGCATGGTGAGTTAGGCCCCCATTTCTACCAATCTACATTCATTTTCAGGTATACACTCACAAGCAAGATGCATTATGGTTTTCACTTGGTTTTCCACCACCTCTTGAGACTCCCTGTGTTTGGATTTCGTCAAGAATCCTCCATCTTATTTGGACACATTCTACATCAGGTTAATAGTAGTTCGATATGCAGTGTACAACCAATGCTGTGTTGCTTCTAAGCAAGTAAACGAAAACGATGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa663
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080372 Nonsense 348 374 4 4
ENSDART00000139102 Nonsense 348 374 5 5
Genomic Location (Zv9):
Chromosome 16 (position 15354684)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13713143
GRCz11 16 13603263
KASP Assay ID:
554-0571.1 (used for ordering genotyping assays)
KASP Sequence:
AGATCTCAGTGAGGGCCGCRTTCCTGGAGCGTGAAAACGCTGCTCTCAGA[C/T]AGGAGGTGGCCGATATGCGCAAAGAGCTCGGCCGCTGCCGTAACATCCTC
Long Flanking Sequence:
CTTTGTTGTAAATAAATTTAGTTTGTTGTATATTAATTATTGTAAAGTAATAAAAGTATATACAGTATGAGCAAATGTTCACGTTAAACAGTTTTTGAAACTAAAATTGATTTATGAATGTATATTAAATATTTCTAACTATCTTTTGACTCGATATTTAAAATATGTGGGTAAGTAATAACAAAATTTCAGTTTTAATGGGGCAAGTAAAAAAAATCCGCTGGCCATTACAATAATTCTTTGGCATTTTGGCCTGTAAACGTCTGAATGTCAGTCTAAAAGTCTTAAATTTGCTGAAACCCTGTGCTTCAAAGATGTTTCTCACTGTAATGTCAGCTCTCAAATAGATCTTTTATTTTTCTTTCCAGGATGAGAAGTACTGGAGTCGGCGTTGTAAGAACAATGAGGCAGCAAAACGCTCTCGCGACGCTCGCCGGCTGAAGGAGAACCAGATCTCAGTGAGGGCCGCGTTCCTGGAGCGTGAAAACGCTGCTCTCAGA[C/T]AGGAGGTGGCCGATATGCGCAAAGAGCTCGGCCGCTGCCGTAACATCCTCAACAAATACGAGAGCCACCATCTGGATCAGTAAATGGAGAGGAGGAACATGTGATAAATGCGATGATGGATGGAGAACGCAATGAATGTCCTGTGATAGACACAAGCTAAGAGACAGAGGAAAGTGCATCGATTATATTGAAAGATGTATGAAGACCGCACAAGCTCAAGTTGTAAACTGGAGAGAGAGAGAGAGAGAGAGAGAGAGCATGTCACCTCTCTTAATAGTTTTTCTTTTTCTTTCTTTATTTCCAGTAAGGTACAATGGTAAGATTTTAATTATGGAGAGAATTGTATATTTTTATATGATAGAACGGGAAAAGGAAATTTTTGAAATTAATTTTTTGTATATTTTCTATATCTTCGTGAGGGCTGTAAAGTACTGATGGAACGGGTCGAGGTATCACTGTAATATAAAATCAGATTTATGTGGTATTTTTGAAGCAATCAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461