Busch Lab

ZMP

adam8b

Ensembl ID:
ENSDARG00000057644
ZFIN ID:
ZDB-GENE-070808-1
Mouse Orthologue:
Adam8
Mouse Description:
a disintegrin and metallopeptidase domain 8 Gene [Source:MGI Symbol;Acc:MGI:107825]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10008 Nonsense Available for shipment Available now
sa41968 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6236 Nonsense Mutation detected in F1 DNA Not yet available
sa22036 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Nonsense 241 819 9 23
Genomic Location (Zv9):
Chromosome 12 (position 9879416)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9087371
GRCz11 12 9125214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTWGATNNNNNGAAACAYACTAAAAACATMAKTCTTTTCTCAGTTGTA[T/A]CGATCTCTTAATATCCGAGWGATGTTGGTGGGTCTTGAGGTCTGGATGAA
Long Flanking Sequence:
ACATTTAGTAGTTTTGATCAGGACTGAGGTTGATTTATGCAACAAAAAAAAGGGAAAAATATGTGTGTGATGCATTTTTACTGCAATTTAATCCAGTGGACGTTTTCATTCCTAACATAACAAAAGGGTAGTCAATTTGAACAGTGCACAAGGGTTAAAGTTTGTTGGCCAATTGTATTAATTTCAAAACAGATATTGCCTGTTTGATTGACTTGGACAATATTTTATCTAATTGCTAATATTTCTACATTATAGATTGACCAAAAAAATATTGTAAATGTTAAGTTATGTTTTACTCTTATAGTACAGAAACTTTGGCTCTAGCATGGATTCTATCAGAGCCAGGATGCTGGAGGTGGTAAATCACGTTGACAAGGTATAAGTTCTTTTTTTTTTTTTTCAAATAGAGTCAATGCTAAATATGTTAAGTCATTAATAATTAATATAAATATTTAGATTTTTTGAAACACACTAAAAACATAAGTCTTTTCTCAGTTGTA[T/A]CGATCTCTTAATATCCGAGTGATGTTGGTGGGTCTTGAGGTCTGGATGAAACAGGACCAGATTGTGGTCAGTGTGAGTTCTGATGACACTCTCAGTCGCTTTATAGAATGGAGGAAGAGCAATCTGCTTAAAAGGGTCAAACATGACAACGCTCAGTTTGTGACGTGAGTATGACCTAATTACCTATTTACTCGGCCGGATGACTGAGATCATTCGCTACACTATAGCAGAGCCTAATGTACTGCACTTTAATATAATGCCCACACTTTACACTAATGTTTTAATGGTTGTCACTTGTTAACTACTAACTAAACTTGCACTTATTTATCACATTAAAGCTATGGTCTCAAACTGAATTCCTGGAGGGCCGCAGCTCTGCATAGTTTAGCTCTAACCACCTCCAACTCACTCCTGCTTAATCGTCTTTAGTAGTCTTGAACAACTTGATTATTTGGATCAGCTGTGTTTCATTAGGGTTGGAGCAAATCTGTGCAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41968
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Essential Splice Site 324 819 11 23
Genomic Location (Zv9):
Chromosome 12 (position 9876994)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9084949
GRCz11 12 9122792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGATTGTTTTTTGTTTTTAAAGACAATTACACAATATGCTGTTATTTTC[A/C]GGATCATAATCAGAACCCACTGGGCCTGGCATCCACAATTGCACATGAGA
Long Flanking Sequence:
CGCAATAGTCTCTGTGGCAAGGGGGCAGGGCCCAGAGCCGTGGGAACGTAATGAGACTGCTGTGTAAGTGGATTCACCTGTAGCGCGCACTGGTCTCGAATCCTAAGGAAGGAGCTCTGGACTTTAAGAGGAGGAACGATGGCAAAAGTAAAACAATCTGTTTGGGCCCGGTCCACTCTCGGGTTCCTCGGCCATCGTTCCTCATCTGGTGAAATTGTATTTAGATTGCAATATATATTGCAAAATAAAAAAAAATCTCAATATCGTGCAGCCCAACTATTAACAGTTTTTTTTTTTTTCCTCTAGTGGAATTGATTTTTTGGGTGACACAGTTGGGTTGGCAAACAAATTTGCAATGTGTGCCGAAAGCTCAGCAGGAGTCAATCAGGTATTCATTGCCTAAATTTGCGATGATTTCTGGTATCAAATTAAATCACGATTTGGAACAAAAGGATTGTTTTTTGTTTTTAAAGACAATTACACAATATGCTGTTATTTTC[A/C]GGATCATAATCAGAACCCACTGGGCCTGGCATCCACAATTGCACATGAGATGGGTCATAACATGGGCATGTCCCATGATGAGGATCACTGCACGTGTGGCTCGTCAGTGATCAGTTCCTTCTGTATCATGACAGAGCGTGTGGGGTAAGCAGTATTTGTGTAATATCATACTGTTTTCATTTGTGCTTTGGTTAGAAGTCAGATCTCTCTGTCTAGTAGCTGGCTACCAGAAATTAAGGCAACATAGGCTCATTTTGAAAACGTAGCCCTATATATATTTCTGGAGATTGTGAATTATGTAGCAGAAGGCATGTATGGCTGCATTTCATCTTTGAAACGAATGCTACGAGGGTGATATGACACTGTTCCTTGTTGTGGTTACCAGCCGACCACTTAGCTCCGATTAGACAGCTTTCCCACTGTTACCAGTTAGTCCAGTTAGCTCGTCATGTATGTCAGAGGACTTGAGATGCAGAGAGAAGTTGGGGTTCGAGTCCGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7686
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Essential Splice Site 560 819 15 23
Genomic Location (Zv9):
Chromosome 12 (position 9861777)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9069732
GRCz11 12 9107575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCTCACTGTGGAAAAACCAAARATGGCATCAGACCCTGTGCAAGAGAG[T/A]ATGTGATGTTTTATMATTTTCCACTTGAAAATAGCTTATAAAATGGTGTT
Long Flanking Sequence:
ATGTAAAAAAAAAGTACATTATGTTACCCAACAGAAGCAATATTTGTCAAATTGTAGTGTCCTCTGCTTGTCGCTGTATGTGGGAGGAGTAATACACAAGGGTGAAGGGTGAATATGCTGTATGAGTGCTGTCTTTTGCAGAATATTGGACGGCTATCAGCAAATAGGATTTAAGAACAAGACAGAACTGTTTTATAAATTTACATATCCAATTTTGTCCACATTATGTATACCAACATATGAATCCCTAAGCCTAAATGTTTTCACGAAAATCCCGTGATTCATTATCACAAGCTGGGCAGAATCTGATGTTTTAGTATCCTGATTTGCATAATAGCTCCTATAAACAAAACATTGATATCTGCTTTAATGTTGTGTCTTTTGCTGTTTCATCAGGTGCCAAAGTGGCTCCTGACACATGCTTTTACCAGAACACATTAGGAAAAAATGATTCTCACTGTGGAAAAACCAAAGATGGCATCAGACCCTGTGCAAGAGAG[T/A]ATGTGATGTTTTATAATTTTCCACTTGAAAATAGCTTATAAAATGGTGTTGTGCAGGGGCAGCTGTATTTTAAAAGTATTTTATGTACAAGCAATGATTATGTTTAATGTTTATAATTATGGTCTGTGAATGAAGGTTGTAAATTTTGAAGTCAGGGATATTTGGGTTGTTAATGTGACATTGTATTTTCACTGTCACACATGACAAAAATGAATGTAATTAGTATTGTCATCATTTAAAGTGCAGTAAATGGTTAAACATAAACAGTTTTCCTGGACCTCTTGTTATAAAATACACATTTTTGAGCCAAATCATAAAAGTGTCCTATGGTGTGACTGTCTCAAGCGTAGTTAAATAAATTACAGCTCTTATGAGCTAAAAAGAACATTGTAAAATCGTTAATGAATATATCAGACCTAGTTTTACAAGTGGCTTCAGTATATTAGTAGATGATAGTGGTGTAACGGATCACAAATCTCACAGTTCAGATCACATTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6236
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Nonsense 638 819 17 23
Genomic Location (Zv9):
Chromosome 12 (position 9859021)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9066976
GRCz11 12 9104819
KASP Assay ID:
554-5369.1 (used for ordering genotyping assays)
KASP Sequence:
ATAAGTGCCAAGAMTTGAACATTTATGGTWGCATTGAAGRCTGTTCACTG[C/T]AGTGCAATGGTCGAGGGGTGAGATCAAAYCTYCTATTATTATATTTATAA
Long Flanking Sequence:
TTCATTAAAAAGTGAATGTTATATATATAACATCATTCTTCAAACTACTTTACGTAAATATTACTGTTTATTCTTCAAAAATGGTGTTTTACAAAAACGAAAATACTTTTACTGCCTATTTACAGCACATCCATGTGCTCTTTCTCCATCATGTTGACATAATTATCCTTTCCCCTCATATAGAAACATGTTTTGTGGAAAGATCTTTTGCAATGAAGGAAATGAATTCCCCGTTACTGGTCAGAAAGCGGTCATAGTAACATTAAGAGGACAGTGCAACGTAGCAGGGGACCAAACAGAGGAGGACGCGCTCAGCATGGTTCCAACTGGCACAAAATGTGGGCATAATAAGGTAAGCATGTAGGAATGCTACTTGGACTTGCTGTTGGAATTTATTCTTAGGCACAAAATAAGTAGTCTCGTGCTTGTTTTAACAGGTTTGCTATGATTATAAGTGCCAAGAATTGAACATTTATGGTAGCATTGAAGGCTGTTCACTG[C/T]AGTGCAATGGTCGAGGGGTGAGATCAAATCTTCTATTATTATATTTATAATTCATAGCATAAAAATACATAACTAGATTGTTACTGTTTGTTGTTTTTGCAGATTTGTAATCATAAAAAACAATGCCACTGTGATCCAGGCTGGGCACCACCTTACTGTAATGTCAAATATTCTGAATTGTCATCTGGTAAATGTTCTATTTTTCTGAAATGTCTTAAACATGTTTAAATAACCTGTAATGTTTTGACACGTTTTACTCTTCTTTCCAACAAGCAAAGACCATTGGCATCTCAGTAGCTGTTGCAGTCGCTGTGCTTGTGGTAATATGTGGAGCCGTGCTTTATCATAAAAAAAGAAAAGCCATCAGCCGCCACAAGACGTGAGTTATATTATTGACATTTGAGCTGAATACTAGTGTCTTGAAAAATCTCTAGTCAAATATTATGTACTGTCATCATGGCAAAGATAAAAGAAATAAATTAATAGAAATGAGTTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22036
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Essential Splice Site 672 819 19 23
Genomic Location (Zv9):
Chromosome 12 (position 9858748)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9066703
GRCz11 12 9104546
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTAAATAACCTGTAATGTTTTGACACGTTTTACTCTTCTTTCCAACAA[G/A]CAAAGACCATTGGCATCTCAGTAGCTGTTGCAGTCGCTGTGCTTGTGGTA
Long Flanking Sequence:
GTGCAACGTAGCAGGGGACCAAACAGAGGAGGACGCGCTCAGCATGGTTCCAACTGGCACAAAATGTGGGCATAATAAGGTAAGCATGTAGGAATGCTACTTGGACTTGCTGTTGGAATTTATTCTTAGGCACAAAATAAGTAGTCTCGTGCTTGTTTTAACAGGTTTGCTATGATTATAAGTGCCAAGAATTGAACATTTATGGTAGCATTGAAGGCTGTTCACTGCAGTGCAATGGTCGAGGGGTGAGATCAAATCTTCTATTATTATATTTATAATTCATAGCATAAAAATACATAACTAGATTGTTACTGTTTGTTGTTTTTGCAGATTTGTAATCATAAAAAACAATGCCACTGTGATCCAGGCTGGGCACCACCTTACTGTAATGTCAAATATTCTGAATTGTCATCTGGTAAATGTTCTATTTTTCTGAAATGTCTTAAACATGTTTAAATAACCTGTAATGTTTTGACACGTTTTACTCTTCTTTCCAACAA[G/A]CAAAGACCATTGGCATCTCAGTAGCTGTTGCAGTCGCTGTGCTTGTGGTAATATGTGGAGCCGTGCTTTATCATAAAAAAAGAAAAGCCATCAGCCGCCACAAGACGTGAGTTATATTATTGACATTTGAGCTGAATACTAGTGTCTTGAAAAATCTCTAGTCAAATATTATGTACTGTCATCATGGCAAAGATAAAAGAAATAAATTAATAGAAATGAGTTAATAAAGCTATTATGTTTATAAATGTGTTGAAAAAATCTTCTATCCGTTAAACAGAAATCAGAAAACAGAAATTGGTTAATCATACCAAATCACCGTATCCTACAGGGGATAGTTCACCCAAATTAAAAATTCTGTCATCAAAATTCTATCATTTATTCACCCTTCACATGTTCAAAACCTATTTGACTTTCTTTCTTATATTGCTGGTCACTGGAACCCACCCAGCTGGCGTGGCCCCTCTGTACTCCAACGTCATGGGACGTTGCATTTTGTTTGA
Associated Phenotype:
Not determined