Busch Lab

ZMP

dusp14

Ensembl ID:
ENSDARG00000057625
ZFIN ID:
ZDB-GENE-041010-162
Description:
dual specificity protein phosphatase 14 [Source:RefSeq peptide;Acc:NP_001006060]
Human Orthologue:
DUSP14
Human Description:
dual specificity phosphatase 14 [Source:HGNC Symbol;Acc:17007]
Mouse Orthologue:
Dusp14
Mouse Description:
dual specificity phosphatase 14 Gene [Source:MGI Symbol;Acc:MGI:1927168]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22602 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22602
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080338 Nonsense 4 221 2 2
Genomic Location (Zv9):
Chromosome 15 (position 14895801)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15940764
GRCz11 15 15876786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAAGGTTTCTACTTCTCTGTCTCCTGCCTCCGCTCCTCTATGGGTTCC[C/T]GAAGTCAGGGCTTCTTCCACCACCAAGACCACCATCACCAGCATCATAAC
Associated Phenotype:
Not determined