Busch Lab

ZMP

arl4ca

Ensembl ID:
ENSDARG00000057606
ZFIN ID:
ZDB-GENE-050417-265
Description:
ADP-ribosylation factor-like 4Ca [Source:RefSeq peptide;Acc:NP_001017749]
Human Orthologue:
ARL4C
Human Description:
ADP-ribosylation factor-like 4C [Source:HGNC Symbol;Acc:698]
Mouse Orthologue:
Arl4c
Mouse Description:
ADP-ribosylation factor-like 4C Gene [Source:MGI Symbol;Acc:MGI:2445172]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45762 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080313 Nonsense 188 192 1 1
Genomic Location (Zv9):
Chromosome 22 (position 14122884)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13953992
GRCz11 22 13978769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGGACAAACTGTACGAGATGATCGTCAAACGAAGGAAATCTCTCAAG[C/T]AGAAGAAGAAACGATAAGACGGTTGGACAATTGCAGAGACATTGAAAGGG
Associated Phenotype:
Not determined