Busch Lab

ZMP

si:dkey-195c14.1

Ensembl ID:
ENSDARG00000057586
ZFIN ID:
ZDB-GENE-030131-9140
Description:
hypothetical protein LOC568041 [Source:RefSeq peptide;Acc:NP_001038615]
Human Orthologue:
SALL3
Human Description:
sal-like 3 (Drosophila) [Source:HGNC Symbol;Acc:10527]
Mouse Orthologue:
Sall3
Mouse Description:
sal-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109295]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43268 Nonsense Mutation detected in F1 DNA Not yet available
sa43269 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43268
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080294 Nonsense 532 1248 3 5
ENSDART00000100181 Nonsense 531 1247 2 4
Genomic Location (Zv9):
Chromosome 19 (position 22552310)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22483690
GRCz11 19 22068013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGATCCCCTATGGGATGTCTTTCCCCCCAGAGAAGGCTGGACCTACTTG[G/A]TTAGACAGCAAACCTGTCCTTCCAACAGTGCCGTCTTCGGTTGGTCTGCA
Long Flanking Sequence:
CTATCAGCTTGCCAGAGTAGCCTCCTTAGCCCTTCTGCCAACCTACCATTACTACCTCAAAGCCCTCCCAACGGAGTCATATTTCCCAATCCACTGGCCAGTATTGCAGCCACTGCCAGTGCACTAGACCCACTGGCTGCTATGATGAAGCACCGCAAGGGCAAACTGCCCAGTGTCTCCATATTTGACAGCAAGCCTAGTTCTGAGGATCCGTTCTTTAAGCACAAGTGTAGGTTCTGCGCTAAAGTGTTCGGCAGCGACAGTGCCTTGCAGATACACTTGCGCTCGCACACAGGCGAGAGGCCATTCAAATGCAACATTTGTGGCAACCGTTTCTCAACAAAAGGAAATCTCAAAGTCCACTTCCAAAGGCACAAGGAGAAGTACCCTCATGTTCAGATGAACCCGTACCCAGTCCCAGAATATCTTGACAATATCCCCACTAGCTCTGGGATCCCCTATGGGATGTCTTTCCCCCCAGAGAAGGCTGGACCTACTTG[G/A]TTAGACAGCAAACCTGTCCTTCCAACAGTGCCGTCTTCGGTTGGTCTGCAGTTGCCTCCCACAGTACCAATTATTGAAAGCCTAAGTGATTCATTTACAAGCACACCCTCAGAAAGGTCTCCACACAGGCCATCACCAGCAAGAGGTGAACTTGCACCGTCGTCGCCAAATCCCACTGGCACTGAGACAGATGTGTCAACCATTGCAGCCTCCCCTAAATCAAACAGAGAGGCAGAGATCACACAGAGTTTCAATACAGAGGAAGTGCACCTACCGTCAAACAGTTTAATCAGAAATGGTAGCAATTCCAACATCCTGCTTTCGCAGTCCATGTTGACAGAAACACCTGTAAAAGGGAATGTACCCGAGTCCACTGATGTTCCTTCAGCCATTATTAAACCGTCCTCTCCACCACTCATCTCAGATCAGTTCAGGAGCAAGTTCCCATTTGGTGGTCTCCAGGATTCTATGCAAACATCTGAGACATCGAAGCTCCAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1086
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080294 Nonsense 1067 1248 4 5
ENSDART00000100181 Nonsense 1066 1247 3 4
Genomic Location (Zv9):
Chromosome 19 (position 22554840)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22486220
GRCz11 19 22070543
KASP Assay ID:
554-0988.1 (used for ordering genotyping assays)
KASP Sequence:
CTGARGTGATGATACCGGGCGTCACCTCACTCAMTGGACCACCTCCACCA[C/T]GACGGACCCCTAAGCAACACAACTGCAGCGCATGCGGAAAGAACTTCTCT
Long Flanking Sequence:
AACACTGATGTGCTACACATTGCCTGACACCGCAAAATAGCTCAACTAATGGTTTGAGTCTTGGGCTGGACTGGTCTGTTTGTTTAAGCGTGGATATACAAGGAGTGTTCATAGAACATTATTAAAAAAATTTATTTTATTAACAATAATATTTTATTTATTTAAAAACGCAATTTTAAATCTGTATCTTAGAGATTTGCTATCTTATCTGTATTTGTAATGTAGATAATTGAATATGAATTAATATTCAATTCACTGTATTGCAATTCCTGTTCAATTGTTTTTCATTCTGATTTTTATTTTTCTCAGAAAATGTTCAAAGGTCTACTGAACAGGATACTAAAAATCTGCCAACTGCAGTGAAACTGGAGATGAGCATTTGCAGTAGACCATACATGCTAAAAGAAGGTCCTTTCCCTGCATTTGGCCTGCAGTCTCCCACCTCACGCTCTGAGGTGATGATACCGGGCGTCACCTCACTCACTGGACCACCTCCACCA[C/T]GACGGACCCCTAAGCAACACAACTGCAGCGCATGCGGAAAGAACTTCTCTTCTGCCAGTGCTTTGCAGATCCATGAGCGCACACACACTGGCGAAAAACCCTTCGGCTGCTCTGTCTGTGGTCGAGCATTCACAACCAAGGGTAATCTTAAGGTACGTAATTATTATTGATTCTGTCATTGTCAGGTGTGCGCAAATAAAAGAAAATATTAAATAAAATAAAATATAATAGAAAATAAAATAGAAAATAGAAATGAAATAAATATAGTTAAATAAAATAACAAATAATAAAATAAAAATTAAATAAACTAAAATAAAATACAAATTAAAATAAAATAAATAAAATAAAAAATTAAATAAAAAATATAGTCAAATAAAATAGAAATGAAATAAATATAGTAAAATAAAATAAATATAATAAAATAAAAATGAACTGAAATAAAATAAAAAAATAATAAAATAGAAGTGAAATAAAATGAAATAAATATTAAATATAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43269
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080294 Essential Splice Site 1117 1248 4 5
ENSDART00000100181 Essential Splice Site 1116 1247 3 4
Genomic Location (Zv9):
Chromosome 19 (position 22554994)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22486374
GRCz11 19 22070697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCTGCTCTGTCTGTGGTCGAGCATTCACAACCAAGGGTAATCTTAAGG[T/C]ACGTAATTATTATTGATTCTGTCATTGTCAGGTGTGCGCAAATAAAAGAA
Long Flanking Sequence:
TATTTATTTAAAAACGCAATTTTAAATCTGTATCTTAGAGATTTGCTATCTTATCTGTATTTGTAATGTAGATAATTGAATATGAATTAATATTCAATTCACTGTATTGCAATTCCTGTTCAATTGTTTTTCATTCTGATTTTTATTTTTCTCAGAAAATGTTCAAAGGTCTACTGAACAGGATACTAAAAATCTGCCAACTGCAGTGAAACTGGAGATGAGCATTTGCAGTAGACCATACATGCTAAAAGAAGGTCCTTTCCCTGCATTTGGCCTGCAGTCTCCCACCTCACGCTCTGAGGTGATGATACCGGGCGTCACCTCACTCACTGGACCACCTCCACCACGACGGACCCCTAAGCAACACAACTGCAGCGCATGCGGAAAGAACTTCTCTTCTGCCAGTGCTTTGCAGATCCATGAGCGCACACACACTGGCGAAAAACCCTTCGGCTGCTCTGTCTGTGGTCGAGCATTCACAACCAAGGGTAATCTTAAGG[T/C]ACGTAATTATTATTGATTCTGTCATTGTCAGGTGTGCGCAAATAAAAGAAAATATTAAATAAAATAAAATATAATAGAAAATAAAATAGAAAATAGAAATGAAATAAATATAGTTAAATAAAATAACAAATAATAAAATAAAAATTAAATAAACTAAAATAAAATACAAATTAAAATAAAATAAATAAAATAAAAAATTAAATAAAAAATATAGTCAAATAAAATAGAAATGAAATAAATATAGTAAAATAAAATAAATATAATAAAATAAAAATGAACTGAAATAAAATAAAAAAATAATAAAATAGAAGTGAAATAAAATGAAATAAATATTAAATATAGTAAAATAAACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACATTAAAAAAATAAAAATGAAATAAAATTAAAAAAAAACAGAATAAAATAGAAATTAAATAAA
Associated Phenotype:
Not determined