Busch Lab

ZMP

mdm4

Ensembl ID:
ENSDARG00000057513
ZFIN ID:
ZDB-GENE-030131-6872
Description:
Protein Mdm4 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUW7]
Human Orthologue:
MDM4
Human Description:
Mdm4 p53 binding protein homolog (mouse) [Source:HGNC Symbol;Acc:6974]
Mouse Orthologue:
Mdm4
Mouse Description:
transformed mouse 3T3 cell double minute 4 Gene [Source:MGI Symbol;Acc:MGI:107934]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa1700 Nonsense Available for shipment Available now
sa38838 Nonsense Mutation detected in F1 DNA Not yet available
sa6207 Nonsense Mutation detected in F1 DNA Not yet available
sa45427 Nonsense Mutation detected in F1 DNA Not yet available
sa10933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1700
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 61 496 4 11
Genomic Location (Zv9):
Chromosome 11 (position 23846273)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22658870
GRCz11 11 22911894
KASP Assay ID:
554-1646.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTTTTTGAACAGGTCATGCATTATCTGGGTCAGTACATCATGATGAAG[C/T]AGCTGTATGACAAACAGAGGCAGCACATCGTCCACTGTCACGATGACCCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38838
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 199 496 8 11
Genomic Location (Zv9):
Chromosome 11 (position 23840456)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22653053
GRCz11 11 22906077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGTGACTCTGGAAGAGTGGGACCTTTCAGGGTTGCCTTGGTGGTTTT[T/A]GGGTAACTTGCGAAGTAATTACACTCGGCGGAGCAACGGTTCCACTGATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27775
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Essential Splice Site 283 496 9 11
Genomic Location (Zv9):
Chromosome 11 (position 23840099)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22652696
GRCz11 11 22905720
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCGCATGAAGATGAGGACACTGGGAAAGACAGTAAAGATGATGGAAAG[G/A]TAACAAGTTTTTTTTTTTTTCTCCTCTTACTGATGTTGTACTGAGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 323 496 11 11
Genomic Location (Zv9):
Chromosome 11 (position 23827478)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22640075
GRCz11 11 22893099
KASP Assay ID:
554-4400.1 (used for ordering genotyping assays)
KASP Sequence:
AGGATGCATGGCAGTGTTCAGAGTGCCGCAAGTTTAAYACCCCTCTTCAG[C/T]GATACTGCATGCGCTGCTGGGCTCTGCGGAAAGACTGGTACAAGGATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45427
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 434 496 11 11
ENSDART00000080201 Nonsense 434 496 11 11
Genomic Location (Zv9):
Chromosome 11 (position 23827143)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGACATCAGAGGGGGATAGTCAGGACACTCTGGACATGGAGACCGAATA[T/A]CAACCTGAGGCCTTGTTGGAACCCTGCAAGCTGTGTCGTGTGCGGCCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10933
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 434 496 11 11
ENSDART00000080201 Nonsense 434 496 11 11
Genomic Location (Zv9):
Chromosome 11 (position 23827143)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22639740
GRCz11 11 22892764
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACATCAGAGGGGGATAGTCAGGACACTCTGGACATGGAGACCGAAWA[T/G]CAACCTGAGGCCTTGTTGGAACCCTGCAAGCTGTGTCGTGTGCGGCCGCG
Associated Phenotype:
Not determined