Busch Lab

ZMP

stk35l

Ensembl ID:
ENSDARG00000057497
ZFIN ID:
ZDB-GENE-041212-52
Description:
serine/threonine kinase 35, like [Source:RefSeq peptide;Acc:NP_001008627]
Human Orthologue:
STK35
Human Description:
serine/threonine kinase 35 [Source:HGNC Symbol;Acc:16254]
Mouse Orthologue:
Stk35
Mouse Description:
serine/threonine kinase 35 Gene [Source:MGI Symbol;Acc:MGI:1914583]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20757 Essential Splice Site Available for shipment Available now
sa7043 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20757
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053187 Essential Splice Site 155 397 1 3

The following transcripts of ENSDARG00000057497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 38777184)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38848784
GRCz11 6 38846320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATAAGCGTTCAAAGCAGTATTTGAGGCTGGTGGAGACCTCGCTGAAAG[G/A]TGAGGGGTGTTAGTTCATTCAAGCAATGCTATTTTGCAATTGTTCTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053187 Essential Splice Site None 397 None 3

The following transcripts of ENSDARG00000057497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 38781359)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38852959
GRCz11 6 38850495
KASP Assay ID:
554-5025.1 (used for ordering genotyping assays)
KASP Sequence:
TTGCGCGGCGTGAACTTTGACCTCTGTCCTAAAAGCATTGCACACACAGG[T/C]ATGTYTCTGCCAAAGGAGTTACCTTTAAAGAACAGATTTGGTTGGTTTTG
Associated Phenotype:
Not determined