Busch Lab

ZMP

immt

Ensembl ID:
ENSDARG00000057454
ZFIN ID:
ZDB-GENE-030131-5417
Description:
mitochondrial inner membrane protein [Source:RefSeq peptide;Acc:NP_001001401]
Human Orthologue:
IMMT
Human Description:
inner membrane protein, mitochondrial [Source:HGNC Symbol;Acc:6047]
Mouse Orthologue:
Immt
Mouse Description:
inner membrane protein, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1923864]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa22456 Essential Splice Site Available for shipment Available now
sa42380 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38989 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35678 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1250
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Nonsense 80 757 3 14
Genomic Location (Zv9):
Chromosome 14 (position 20025405)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15790140
GRCz11 14 16095703
KASP Assay ID:
554-1165.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAAATGGGACCCAAAATTTCGGTCATCTRTAGAGAAGAGTGTTCCCTA[T/A]TCGGATCAACTATTTGACATGGTGCTAGGGGCACCCCCTTCTCCACCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22456
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Essential Splice Site 188 757 5 14
Genomic Location (Zv9):
Chromosome 14 (position 20032529)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15797264
GRCz11 14 16102827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCGCACCAGGTACAAGTGATGAAAGCCCATCTGGCCACTCGGCGGCAG[G/A]TCAGCATTGGATCATTCACAGTCTTCTGCTTATGACAACTGATCCACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42380
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Essential Splice Site 273 757 8 14
Genomic Location (Zv9):
Chromosome 14 (position 20040740)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15805475
GRCz11 14 16111038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGCGTGCGTGTGTGCATGTGTGTGTGCATGTGTGTGCCCA[G/T]ACTCCTCCAGATGAGAAGTCCACTCAGGCACTGAATGAGGCTCTGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38989
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Essential Splice Site 394 757 10 14
Genomic Location (Zv9):
Chromosome 14 (position 20044730)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15809465
GRCz11 14 16115028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTTGCCAACATCACACCTGAGATCCAGGCCAACTGGAAAGGACTATG[T/A]AAGATATCACACTCTTTACATGGATTCAAGTTCTCTACATTTTATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Nonsense 561 757 14 14
Genomic Location (Zv9):
Chromosome 14 (position 20052194)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15816929
GRCz11 14 16122492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCACATATCAAATATTTGTTTTGTCTTCAAGGTCATGTGATTGCT[G/T]AGGAAGAGGCTCGTAAAGCTCACCAGCTGTGGCTTTCGGTTGAAGCTCTA
Associated Phenotype:
Not determined