Busch Lab

ZMP

si:ch73-119j17.3

Ensembl ID:
ENSDARG00000057439
ZFIN ID:
ZDB-GENE-100922-277
Human Orthologue:
PHF1
Human Description:
PHD finger protein 1 [Source:HGNC Symbol;Acc:8919]
Mouse Orthologue:
Phf1
Mouse Description:
PHD finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:98647]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9170 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa15490 Nonsense Available for shipment Available now
sa42809 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa22939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9170
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Splice Site, Nonsense 21 519 1 14
ENSDART00000134471 Splice Site, Nonsense 26 326 2 11
Genomic Location (Zv9):
Chromosome 16 (position 48489728)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45458949
GRCz11 16 45425665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTTTTGGCCAGGTGGAGCGATGGACTTTTATATCTCGGCAATGTYAAA[C/T]GAGTAAGTTTCTCCAAGTTTGTTCGGAGRAGGGAGCCGGTGGARAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15490
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Nonsense 272 519 9 14
ENSDART00000134471 Nonsense 277 326 10 11
Genomic Location (Zv9):
Chromosome 16 (position 48504181)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45473402
GRCz11 16 45440118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTCAGACACGCCRAGGCAAGACCGTTGCCAAAACCTGCTCAACGCTT[T/A]AAACTCCCACAAAGACAGGTGAGACAYGGATTACGCTCGGAAAAAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42809
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Splice Site, Nonsense 368 519 11 14
ENSDART00000134471 None None 326 None 11
Genomic Location (Zv9):
Chromosome 16 (position 48505888)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45475109
GRCz11 16 45441825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGAAATCAAACATCACTGTCAAGAGTTTGTACAAGCACACAGA[C/T]AGTTGAGCTTGTTTTTCTTGTAGTCTTTTAATTATTTTTTGCAAGATGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7812
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Splice Site, Nonsense 433 519 13 14
ENSDART00000134471 None None 326 None 11
Genomic Location (Zv9):
Chromosome 16 (position 48507023)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45476244
GRCz11 16 45442960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCCATCATACAACGCATCTCAGGACCTGTCTAGAGCTCTTCACCACTA[C/A]AGGTCTGTCTGTCAGCAAAATATACWCACTCAAATCACACCAACTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22939
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Nonsense 484 519 14 14
ENSDART00000134471 None None 326 None 11
Genomic Location (Zv9):
Chromosome 16 (position 48507703)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45476924
GRCz11 16 45443640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCGGGACGTGCCTCCCTTCCACAGCCCCGTGGGCATGGCTGCACCAT[C/A]GAGCATGGGCTGGGCAGGAGGAGATGCTGTCCGAATCCTTGCCCGACGCG
Associated Phenotype:
Not determined