Busch Lab

ZMP

rnf103

Ensembl ID:
ENSDARG00000057438
ZFIN ID:
ZDB-GENE-040912-171
Description:
RING finger protein 103 [Source:RefSeq peptide;Acc:NP_001004600]
Human Orthologues:
RNF103, RP11-269K22.1
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B8ZZK9]
ring finger protein 103 [Source:HGNC Symbol;Acc:12859]
Mouse Orthologue:
Rnf103
Mouse Description:
ring finger protein 103 Gene [Source:MGI Symbol;Acc:MGI:109483]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22455 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2765
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080114 Nonsense 549 656 4 4
Genomic Location (Zv9):
Chromosome 14 (position 20020510)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15785245
GRCz11 14 16090808
KASP Assay ID:
554-3289.1 (used for ordering genotyping assays)
KASP Sequence:
AAGCCAYGATGAACCAAAATGAGGACTCCAGTGGGAACAAGGWAGCGCAT[C/T]AGTGCAGTYCAGACGTTCTWCATGATCATTACGGGTGTTCAGCTGCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22455
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080114 Nonsense 571 656 4 4
Genomic Location (Zv9):
Chromosome 14 (position 20020578)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15785313
GRCz11 14 16090876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACATGATCATTACGGGTGTTCAGCTGCAACCAAGTCAGAAGAGAGTTG[G/A]TCTGGTGGAGAGGAACAGGACACTGATTGGTCTCAGTGGCCTTGTGGTAT
Associated Phenotype:
Not determined