Busch Lab

ZMP

c1qtnf3

Ensembl ID:
ENSDARG00000057435
ZFIN ID:
ZDB-GENE-050522-484
Description:
alpha-methylacyl-CoA racemase [Source:RefSeq peptide;Acc:NP_001018462]
Human Orthologue:
AMACR
Human Description:
alpha-methylacyl-CoA racemase [Source:HGNC Symbol;Acc:451]
Mouse Orthologue:
Amacr
Mouse Description:
alpha-methylacyl-CoA racemase Gene [Source:MGI Symbol;Acc:MGI:1098273]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18251
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080110 Nonsense 104 382 3 6
Genomic Location (Zv9):
Chromosome 21 (position 18250341)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19385830
GRCz11 21 19422466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGGATTAGGTCCTGAAGACTTAATAAAAGAGAACCCCCGCCTGATCTA[C/A]GCACGTCTCACTGGTTAYGGTCAGAGCGGATCCTWTGCMAAGGCTGCCGG
Long Flanking Sequence:
AAGTATGCCTCTGCTTTTACAGTTTCTTAATTTTACACTTTTTATTTTAGTTATTATGTGACTAATGATTAACAGTTGTTACAAATCAGCTTAATAAAGGTTAAAAGCAGAACAACAAATACAATAACAATGGTCTTTTTAATAAAACATGCTCCATTATCACAATTAGTTCTTCTTGTTTGCAAATCAATTATTGTTTTAACAATTAACCTCTGTCCATATGGTGCCTTTGTCTACATAATTTAATCAGTTTTAATTAAAGCATTGTTGATTTAATGAAAAGGGGAAAACAATTCTTGACTTAAAAGAGAGATTGCCATTTCCCTCCTGATTTTAAATCCAAACAAGAATAATTTGTCCTCTAAATTCAAATGTATTTACCTTCAAGGTTTCCTCTGTTCATGCTTCATTATTGTATCTCTCTGGTATAATTAAGGCGTTATGGAGAAGATGGGATTAGGTCCTGAAGACTTAATAAAAGAGAACCCCCGCCTGATCTA[C/A]GCACGTCTCACTGGTTATGGTCAGAGCGGATCCTATGCCAAGGCTGCCGGGCATGATATCAACTACCTGGCCATGTCAGGTAAGACCACTGTTAAACAGGTGCAGAGAAGCTCAGCTAATATGCTTTCCCACAATGCCCTTAGGCACAGTGCTTGTAAAGCAGAGTAAATTAGAGAGATCGAGCAATATGTGAAGTTTGGAAAGACTTTGGTGGAAAACTTTTCTTAAGAAGAGTTTAACTTTCATGTCTTCCAAAGGTTTGAAAAAATATAGATATATATTTTAGGAATACTAAGCATGTGTCAACGGCAAAAAAGGAACTAAATTGCTAATACATCTTAAATTTGCATAATTTATCCATTGCACCCTGTTTAAATTTGTTCTGAGCAAAAAAAAAGCTACTATTTATTTTTTACCCTGATTTACAGAAGGCACCTATTAAAATGTAATTTAGTGTGAGAATATTTTATGCCACACAATCTTGTCAGGCATATTTTAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7955
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080110 Nonsense 273 382 6 6
Genomic Location (Zv9):
Chromosome 21 (position 18268919)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19404408
GRCz11 21 19441044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCACAAATGAGCRTTWCTGATTGGCCGCAGCTCAGGSAGACTTTYACA[C/T]AGGTGTTTGCCACMAAAACACAAGCASAATGGGGTCAGATCTTCGACGGG
Long Flanking Sequence:
AGCCATTTTCAATTCTCCAGAAATAAACCTGTAGCCTGAAGGACATATGAGTATAGCTGACATGTTCAACCACAAGTCTCTCTGGGTCACCTTGATCTGTTGTCGATTTTGCAAAGGCATGATATAATATGAAAGATTAGAAAGAATCCACAGGATGCTTTATTAATATGTGCCCAGGGACTCACCTTATACCCAAGTACAAACGCAGCCCTCTTGATCTTGCTATAAAATCATAATGACTCAATTGCAATTCAGGTTTGACCCTCAAAAGCAGCACGTCTCTGTACAAGTCCCCTACTGTGGGCCAGTGTTATGTACTAATGGCTTCAGGATCCACAGCCCTCCCTCTCCTCTAAACTCCTTTATTGATTCCCTTCCTCTTTTTAATCTCCTCTTCATCTCGCTGATTCTCTCTTACCACAGGTTTGGGATTGGACGACACTGACCTGCCCTCACAAATGAGCGTTACTGATTGGCCGCAGCTCAGGCAGACTTTCACA[C/T]AGGTGTTTGCCACAAAAACACAAGCAGAATGGGGTCAGATCTTCGACGGGACAGATGCCTGTGTCACTCCTGTTCTGTCTCAGGATGAGGTGCTTTCTCATTCTCATAACCAGGCGAGAGGGTCATTCCTCAAAGACTCTCAGGGGGAAATTAGCCCCCGTCCTGCACCGGTGCTGTCCCGTTCCCCAGCAGAGCCCTGTGGATCCCGTGACCCCTTCATTGGAGAACACACTCGGTCAGTGCTAAAGGAATACGGGTTTGATCAAGCGCAAATCGAGCAGCTTCTGTCTGCCGGGATCGTAGAGTGTAACGAAGCTAAAGCGCGACTGTAAATGAAGGAGTTTGAGTGGAGAGCTAACTGTGTATGCAGTGATGCAGAGGAATCAGACATCATTTCTATCTCACATTTCAGAGCAGAGAGAATCCCTTGTGAATTGCTGCTTCAGTCGAGGTGGACTTAATGATTTTGGGCTTTTAAGTTAACCTGTCCAACAATTCAG
Associated Phenotype:
Not determined