Busch Lab

ZMP

mxd3

Ensembl ID:
ENSDARG00000057432
ZFIN ID:
ZDB-GENE-040426-1588
Description:
Max dimerization protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7SX95]
Human Orthologue:
MXD3
Human Description:
MAX dimerization protein 3 [Source:HGNC Symbol;Acc:14008]
Mouse Orthologue:
Mxd3
Mouse Description:
Max dimerization protein 3 Gene [Source:MGI Symbol;Acc:MGI:104987]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31982 Nonsense Available for shipment Available now
sa31981 Essential Splice Site Available for shipment Available now
sa42379 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080103 Nonsense 18 200 1 6
Genomic Location (Zv9):
Chromosome 14 (position 20012188)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15776923
GRCz11 14 16082486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGTAAATACGTGCAACATCCAAGTGCTTCTGCAGGCAGCTGAATATT[T/A]GGAGCGGAGGGAAAGAGGTAACTAAAGTGCCGTTTCTTTCTCATGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31981
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080103 Essential Splice Site 59 200 2 6
Genomic Location (Zv9):
Chromosome 14 (position 20011405)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15776140
GRCz11 14 16081703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAAGAAGCAGAAATCAAAGAGCCATTCATCACCAGGGAACAGCAG[G/A]TGAGTGTGAGGTGCACAGACGAACGCGCCCCCGTTCTTTTGTCCCTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080103 Nonsense 76 200 4 6
Genomic Location (Zv9):
Chromosome 14 (position 20008444)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15773179
GRCz11 14 16078742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATGTGATATTGTGTGTGTGGTTGTAGGAGAGCTCAGTTAAGACATTG[T/A]TTGGAGCAGCTGAAGCAGCAGGTTCCTCTGTCCTCAGATTCATCAAGAAA
Associated Phenotype:
Not determined