Busch Lab

ZMP

phb

Ensembl ID:
ENSDARG00000057414
ZFIN ID:
ZDB-GENE-030131-6577
Description:
prohibitin [Source:RefSeq peptide;Acc:NP_958454]
Human Orthologues:
AC079322.1, PHB
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9K0S8]
prohibitin [Source:HGNC Symbol;Acc:8912]
Mouse Orthologue:
Phb
Mouse Description:
prohibitin Gene [Source:MGI Symbol;Acc:MGI:97572]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38378 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080075 Essential Splice Site 29 271 None 7
ENSDART00000108487 Essential Splice Site 67 309 None 7
Genomic Location (Zv9):
Chromosome 3 (position 15342080)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15587686
GRCz11 3 15737486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGCCTTGGCCATTGGAGGAGGTGTTGTTAACTCTGCTCTGTACAATGG[T/G]GAGTTGTAATAACTACTGATGTGTTTTGTAAAACAATGGCAGCAATGGTT
Associated Phenotype:
Not determined