Busch Lab

ZMP

si:ch211-130m23.3

Ensembl ID:
ENSDARG00000057395
ZFIN ID:
ZDB-GENE-060531-14
Description:
single-stranded DNA-binding protein 2 [Source:RefSeq peptide;Acc:NP_001103848]
Human Orthologue:
SSBP2
Human Description:
single-stranded DNA binding protein 2 [Source:HGNC Symbol;Acc:15831]
Mouse Orthologue:
Ssbp2
Mouse Description:
single-stranded DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914220]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33698 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20519 Essential Splice Site Available for shipment Available now
sa33697 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33698
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080033 Essential Splice Site 18 350 1 17
Genomic Location (Zv9):
Chromosome 5 (position 47884955)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45673695
GRCz11 5 46273848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCCAAAGGCAAGAGCAGCGTGCCGTCGGACAGTCAAGCCCGAGAAAAG[T/A]AAGTTATTGATCAGTAGATGGAGGAGATCGCATCTGCAGCCGCGCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080033 Essential Splice Site 203 350 10 17
Genomic Location (Zv9):
Chromosome 5 (position 47821946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45610686
GRCz11 5 46210839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTATTGCTACTTCTGTATAAAATAATATATCTGTGTACTATATGTAA[A/G]GGGGTCCTGCAGGAGGAAGACCATGGCCAAATCCTCCAAATAACAACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33697
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080033 Essential Splice Site 342 350 17 17
Genomic Location (Zv9):
Chromosome 5 (position 47818154)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45606894
GRCz11 5 46207047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTAAATACAGCTGCAGATATCATTCAATGCCATCTTCTGTCTTACA[G/A]TATTCTCCTAACATGACAATGAGTGTGTGAGAGGACAGCACAGGAGCAAA
Associated Phenotype:
Not determined