Busch Lab

ZMP

LOC100332844

Ensembl ID:
ENSDARG00000057353
Human Orthologue:
EHBP1L1
Human Description:
EH domain binding protein 1-like 1 [Source:HGNC Symbol;Acc:30682]
Mouse Orthologue:
Ehbp1l1
Mouse Description:
EH domain binding protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:3612340]

Alleles

There are 17 alleles of this gene:

Allele Name Consequence Status Availability
sa30627 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20889 Nonsense Available for shipment Available now
sa38600 Nonsense Mutation detected in F1 DNA Not yet available
sa34026 Nonsense Mutation detected in F1 DNA Not yet available
sa20890 Nonsense Available for shipment Available now
sa15934 Essential Splice Site Available for shipment Available now
sa15513 Nonsense Available for shipment Available now
sa34027 Nonsense Available for shipment Available now
sa20891 Nonsense Available for shipment Available now
sa16586 Nonsense Available for shipment Available now
sa12016 Nonsense Available for shipment Available now
sa44652 Nonsense Mutation detected in F1 DNA Not yet available
sa1940 Splice Site, Nonsense Available for shipment Available now
sa1555 Nonsense Available for shipment Available now
sa40856 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11356 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30627
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Essential Splice Site 164 4318 5 33
Genomic Location (Zv9):
Chromosome 7 (position 19262958)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17764341
GRCz11 7 18016314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCAAGCTCACCCTGTCCTGCGTCTTCCTGAAGGAGGGCAAAGCTACG[T/A]GAGTTCAACAGACCATCGGCAGTGCGAGGATAAAGAACGAGCCTCCTCCA
Long Flanking Sequence:
TATTCAAATCACAATAATTATCACAGTATAATAAAATATTGCAATGTTACATTTTTACAATATCGTGCAGCCCTATTTGCAATGCAAACTAAAATGCTTAAAAGTGTGACCTACTTCTTTATTTTTTGGCTTTGTAATAAGCTCATGCTATCCCAGAAACGTAGTATTTTGGAGAGTTTTGTCCTGTAAGAGATATCACTTTTGCTGTAGCGTGTCTTTAATTTTGTTCTGATTGCTTTATTTTTTGATTAAATTTTTGCTTTATTTAAAAGTAGTGCTCTTTTAAAACATCTAACCCCATCTCATCCCAACATCCACAGGAAACAAAGGGTCACAGAAAAGTTTTAGCGTCAGTGGATGTGAATATGAAGAAGTTTGCAAGCGCGACCCCGGCTCAGTTTGACCTGTCGCTTACACTGAAGCCTCTTTCTGTGAAAGTGCTGGACGTCACACTCAAGCTCACCCTGTCCTGCGTCTTCCTGAAGGAGGGCAAAGCTACG[T/A]GAGTTCAACAGACCATCGGCAGTGCGAGGATAAAGAACGAGCCTCCTCCAATCGGCCTTAACTTTCACTGTTTTTTTTCTTCTTCGTGGAATGGTGTTGTGCACTCCACTGAAGACATCCATTAGCCTACATATTTAATTTTGTTCGTTAAGCGCAAAGATTTGTTCTAAAACTATTTCTAAATTCAGTTCTATATACCAGCAAACAAATAAATGAACAACAGTGATGAAGTGTGGTCAAAAAACACTGTATTTCTGTATTACTCTACATCCTGTGTGTTTTAAGCAATGTGTAAGCGAAGCGCATAACTGACGCACCCTGCGCTGGACTTTAGACCTGCTTTCAGCTGGTCTATTTCTCAGTCTGTTTTAGTCCCTCAAAATAGCAACGCGCCAACAATGCGCCTTAACACACCTCTTTTCCAGACTCGAACACCCATGAGTCCACAAAGTGCGACAAATGAATTTACTATTTAAACAATGTGGTAGAAAATGGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20889
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 587 4318 11 33
Genomic Location (Zv9):
Chromosome 7 (position 19277355)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17778738
GRCz11 7 18030711
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTCTCCTGTCTACTCCTCATCCCGCTGTTTCTGATGCTCCTCTGTG[T/A]CTCACTTCTGATGTTGGTCCTGTGGTCATCACTCCTGTTTTCTCCGATCC
Long Flanking Sequence:
CCTCTCTCTCTTTTTCTCTTTTTTCCCTGTGTTCTGCATACATACACACTCACTGGTTCATTCATCAACTTTCATCATTGACCAACGAAATCATGCTCCACTCCAGCATCTTGGCAGAAAGAGTGGAGATCTCCAAAGCTGCGGCCTGCTCTGTGTCCTGCTCCATCCACATCCTCACAACATACTAACCAGCAGCTTCGCCCTGCACAAACACATCCTCTAATGCATGCCCCCATTCTCACACTCCCTTCACCCCCGACCGTGGTGTTTTCCACTGCTACTCCAAATCCTGGTCTAACATCTCCCAGTGTCGCTCCCTCCTCTGAGATACTCAGCCCTGTCTCTGTCCCTCAAACGCTGTCATCTGCCATCCTCACTCCTCCTCCAGCATCACTTGTTGGCCCCATTGCTCCTAGTTCTAGTTCTCCATCTGCCCCTTTTCCCTGTGTTTCTGCTCTCCTGTCTACTCCTCATCCCGCTGTTTCTGATGCTCCTCTGTG[T/A]CTCACTTCTGATGTTGGTCCTGTGGTCATCACTCCTGTTTTCTCCGATCCAGGTAGAGAGAGAGAAAATATACTCCTGATGACTATTTTAAATCTGTCTGCATGTGTTAAATTAATGTAACGATCTGTTTTCATCTTATGAGTTTCAGATGAAAATATTGTCTGCAGTGTGAACAGATTTTGGATGCCCTTTTTGTGGAGTGTGAATATTGTGAAAACTCTAAGACTCGCTGTTTAAATCAATCATGCCTTGTTTTTTTTAAAGGAATAGGTTTATTCAAAAATGAAAGTGTCATTTAGGCGGCACTTTGGCTCAGTGGGTAGCACTGTTGGCTCACAGCAAGAAAGTTGCTGGTTCGAGTTCCGACTGGGCCAGTTGGCATTTCTCTGTGGAGTTTGCATGTTCCTCTTATGTTCATGTGGGTTTTATTCCGGGTGCTTTGGTTTCCCCCACAGCAGTGTTGAGGAAAGTTACTTTTGAAAGTAATGCATTACAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38600
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 1190 4318 16 33
Genomic Location (Zv9):
Chromosome 7 (position 19291155)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17792538
GRCz11 7 18044511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAACCAATCCAGTTTGCCACGAATTGTAAATGTATCAAAAGAAGATTG[T/A]TTAACCAGTATGGTGAGCTTAGTGCCATCTTGCCCAAGGAAAGCAAGGAC
Long Flanking Sequence:
TTAGCTTGTCCAAAAGCTGCCAACATTCCTGGATTTCCATCTATGCCTTTCTGTGTGGTCAGTCTTCCACCATTATGTCCAGATGTTTCTGAAATTCCAGGTTTTTCTTCAAGATATCCAAGCCTTTGCACAGACAAACTCTGGCCTAAAAAGAATGTAGTGATTTGTTTTAGGAGAAATAAGAGACAGATTTTACCAACATCATCAATGAAGATAAATGATGAAATGACAAGAACTATGTTTGCGATTAGACCGTCTTGTTCAGCTTCACCTAAGATTTCAGGATTTCCATCCGCTCCAAAACCAGTTGCACCAAACATGGTCAGGATTTCACATTGCTGTCCAAAGGTTTCCAGTATTGCTGGATTTCCATCTGCAAAAGTCTTTGCTGTTCAAAATCTCTTTCATATGTGGCCATCCAATAATGAAGCATCTCTGATAACAGCACAAAAGAACCAATCCAGTTTGCCACGAATTGTAAATGTATCAAAAGAAGATTG[T/A]TTAACCAGTATGGTGAGCTTAGTGCCATCTTGCCCAAGGAAAGCAAGGACTCCTGGTTTTCCAAGTGCACCAAAACAAGACATCACATTCTCTATAACAAAACTCCTACCTTTATGTCCATCAGCTTCTTGTGTCGCTGGAATATCATCTATACAAACTCTTACAAGCGAATTAGATTCATTTCAGAAATGGCCAAATGACAAACCATTCTGGATCAAGACATTGGCCTCCCAGCCATGTCGTTTTATCAATGCACATCCAGCTCAGTATGAAGTTACAGAAGACAAGTATATTTTCAACAATATGCTGTCATTAATATCATCATGCCCCAGAAAAGCAAGAAGTCCTGGACTTCCTTCTGCACCATGGCTCATGCCTGAAACACAAATAACATCTGGTACTTTATCAGCATGTCCACAAACCTCTAAAACACCAGGCTTTCCCTCTTTAGTCCCAAGCAAGCTTGACAAGGCTGTGGTTAATATTTGGCCTTTTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34026
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 1270 4318 16 33
Genomic Location (Zv9):
Chromosome 7 (position 19291395)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17792778
GRCz11 7 18044751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCAAATGACAAACCATTCTGGATCAAGACATTGGCCTCCCAGCCATG[T/A]CGTTTTATCAATGCACATCCAGCTCAGTATGAAGTTACAGAAGACAAGTA
Long Flanking Sequence:
TTTGCGATTAGACCGTCTTGTTCAGCTTCACCTAAGATTTCAGGATTTCCATCCGCTCCAAAACCAGTTGCACCAAACATGGTCAGGATTTCACATTGCTGTCCAAAGGTTTCCAGTATTGCTGGATTTCCATCTGCAAAAGTCTTTGCTGTTCAAAATCTCTTTCATATGTGGCCATCCAATAATGAAGCATCTCTGATAACAGCACAAAAGAACCAATCCAGTTTGCCACGAATTGTAAATGTATCAAAAGAAGATTGTTTAACCAGTATGGTGAGCTTAGTGCCATCTTGCCCAAGGAAAGCAAGGACTCCTGGTTTTCCAAGTGCACCAAAACAAGACATCACATTCTCTATAACAAAACTCCTACCTTTATGTCCATCAGCTTCTTGTGTCGCTGGAATATCATCTATACAAACTCTTACAAGCGAATTAGATTCATTTCAGAAATGGCCAAATGACAAACCATTCTGGATCAAGACATTGGCCTCCCAGCCATG[T/A]CGTTTTATCAATGCACATCCAGCTCAGTATGAAGTTACAGAAGACAAGTATATTTTCAACAATATGCTGTCATTAATATCATCATGCCCCAGAAAAGCAAGAAGTCCTGGACTTCCTTCTGCACCATGGCTCATGCCTGAAACACAAATAACATCTGGTACTTTATCAGCATGTCCACAAACCTCTAAAACACCAGGCTTTCCCTCTTTAGTCCCAAGCAAGCTTGACAAGGCTGTGGTTAATATTTGGCCTTTTAAGGAGAAAGCATTTATAGAGCGAAGGTGTTTGCCAGAGTACACATTTGACAAGTTAAACATTGCTTATCAGAACAAAGCAAATCTTAAAGGAATGCATGCTATTTTGTCGAGTTGTCCAGTAAAAGCAAAGATTCCTGGATTTCCATCTGCACCGAAGCCCAAATTAATGCTTTATCTTTTACCTTCATGCCCAAGAATCTCAAATATACCTGGGATGGTATCAAGCATAATACCTGAAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20890
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 1330 4318 16 33
Genomic Location (Zv9):
Chromosome 7 (position 19291573)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17792956
GRCz11 7 18044929
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTCATGCCTGAAACACAAATAACATCTGGTACTTTATCAGCATGTCCA[C/T]AAACCTCTAAAACACCAGGCTTTCCCTCTTTAGTCCCAAGCAAGCTTGAC
Long Flanking Sequence:
CCAATAATGAAGCATCTCTGATAACAGCACAAAAGAACCAATCCAGTTTGCCACGAATTGTAAATGTATCAAAAGAAGATTGTTTAACCAGTATGGTGAGCTTAGTGCCATCTTGCCCAAGGAAAGCAAGGACTCCTGGTTTTCCAAGTGCACCAAAACAAGACATCACATTCTCTATAACAAAACTCCTACCTTTATGTCCATCAGCTTCTTGTGTCGCTGGAATATCATCTATACAAACTCTTACAAGCGAATTAGATTCATTTCAGAAATGGCCAAATGACAAACCATTCTGGATCAAGACATTGGCCTCCCAGCCATGTCGTTTTATCAATGCACATCCAGCTCAGTATGAAGTTACAGAAGACAAGTATATTTTCAACAATATGCTGTCATTAATATCATCATGCCCCAGAAAAGCAAGAAGTCCTGGACTTCCTTCTGCACCATGGCTCATGCCTGAAACACAAATAACATCTGGTACTTTATCAGCATGTCCA[C/T]AAACCTCTAAAACACCAGGCTTTCCCTCTTTAGTCCCAAGCAAGCTTGACAAGGCTGTGGTTAATATTTGGCCTTTTAAGGAGAAAGCATTTATAGAGCGAAGGTGTTTGCCAGAGTACACATTTGACAAGTTAAACATTGCTTATCAGAACAAAGCAAATCTTAAAGGAATGCATGCTATTTTGTCGAGTTGTCCAGTAAAAGCAAAGATTCCTGGATTTCCATCTGCACCGAAGCCCAAATTAATGCTTTATCTTTTACCTTCATGCCCAAGAATCTCAAATATACCTGGGATGGTATCAAGCATAATACCTGAAGCAGAACTACAGTGGCCTGTAAATAAAAAGCCATTATGCTTTAAACAACTGAGCAGAAAGTGCCAGTCTATACAGGCTGTACCACCTCAATACACGGAAATAGAATATAACGATATGCTAGCATTGCGTCCAACTTGTGCAACCAGGGCTAAAGTGCCTGGATTTCCATCTTCCCCAAGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15934
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Essential Splice Site 1667 4318 16 33
Genomic Location (Zv9):
Chromosome 7 (position 19292586)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17793969
GRCz11 7 18045942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGYTTTTTGGGAAGAAGTGAGGAAGGACAAAAGGGAATTCTGGAAAGGGG[G/A]TAAGTTCAGAATTACCCACGTGTTTGTTAYACCAACAAAGAAAATRTACA
Long Flanking Sequence:
GCAACACCAGATATGGCATCGCTCAAGCCATCTTGTCCTCATTTGACAAAATTGTTAGGTATGCCATCTATTGACTTAAGAAATGAAGCAATGGGTTCAGGTGCATGGCCTCATGATGCAAATCAGCTGCATATAAGGACCTCAAAGGATGACATGATATGTTTATCTTTAAGAAACTTGAATCAGCCATATGATGCCTACCTGAATTTCCACACAGAAGACATGTCTATGATGATGCCATCCTGTGCAAAGCAATCCAATGTCCCTGGCTTTCCATCCACATATTCAGAATCTCTACAAATGCTTTATCAGACCCAAGCACAAACAGACAATGTTGGCGATAAACAAGAGACACCAACTGTGCTTGATCAAGCAGATACTGAGATGGACCTCTGCAGTGCAAATGAGTCTGACAGTAGTTTTGCATTTGAAAAGACCAAGGAGAATGTGAGCTTTTTGGGAAGAAGTGAGGAAGGACAAAAGGGAATTCTGGAAAGGGG[G/A]TAAGTTCAGAATTACCCACGTGTTTGTTATACCAACAAAGAAAATATACAGTGCGCATCCTGCAGTGCATGAAATACTTTGACACTTGTTTCTAGGAAGATGCATTGCAGAATGTGGCACTCCTTACCAGACATGCCACTATTACTGACTGTTGAGGAGAGGTGAGTTTTGCAAAGAAACAAAGATAAAGAGTATTAACTCAATGCTTTGCCTTGCCCAAATCAGATGTTTTCCGCCTGCAAATAACATTTATATATTTTTCACTTTACAGTAAGTGCATAGTTCTTCCCAAAGTGAAAAAGCTGTAATAATTTACTCAACCTTTTGTCTTTACATGTAAACAAATGTGGTCCAATTTTAAAGAGCCCCTATTATGCATTAAAAAAGGTAATATTTTTGTTTTGGGCTTCTCCAGCAACAGTCTGATATGCATGCAAGATTAAAAAACATTTTTTTTGTCTTATAATAAGCATTTCTTTTTACCTAATTATTCAAACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15513
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 1965 4318 18 33
Genomic Location (Zv9):
Chromosome 7 (position 19295428)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17796811
GRCz11 7 18048784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGRTGATTCCATMCCTGCGGATGAGACCKTCATATCTGRATTACCKTCA[C/T]AAAWCCCAGATTCAGTCCCTACATCCCAAASAGAMCCAAATATGTTGGAG
Long Flanking Sequence:
AAATGAGTCTAATTTGGGATGAACATCATGAATCATCAAAAAATATGTTGTTTATGCCATACCTGGAAAAATCCCCCTGTGAGGGAAATATGGTGTCTCTGACATCCACATGTCCAAATGAAGCAAGAATTCCAGGCTTTCCATCTGCTAAGAGACCCACAGAGGCCTCATCTCCATCCGATCCAGAAACATCCATTATTGTTGACACATCTTCACTGACCCTAAATCCAGAGGAAAAGGAGGAGCAGCTGAGCATGGAAACATCATTACTGGAAGACCTTTCAAAACCAAAGCCAGTTTTGGACATCGACAGCCTTATTGAGCATTCAGAGATTCAATGCTCAAAACTTGTTCCTGATTTCCAATCTGCACCAAAAAGTAAAGAAATAACTATTCAGTCATGTGAGGAACTAACACTTCAGTGGTCAACAATAGTGGAGACCAAACTGAGGGGTGATTCCATCCCTGCGGATGAGACCTTCATATCTGAATTACCTTCA[C/T]AAATCCCAGATTCAGTCCCTACATCCCAAACAGAACCAAATATGTTGGAGCTCCTTCCATCCTGTCCGGTGCTTTCTAGAATCCCTGGATGTCCATCTTTAAGGGTAATCGAAGACAGGGAGTACATCTGTAATCAGTCAATAATATTTAGCCATTTATTAAAGGATAGGCAAACAGGCATTTTTAAATCTAGTAACGATAAACCAGATACAAAGATTATAGCACTGGCACCAACATGCCCTCAATCATCAAGCATTCCAGGATTTCCATCAAGACCACACCTTAAATCACAGATGAAGCCAAACATGATAAACATTGGTCCATCTTGCCCAAAGATTTCAAATATAGCTGGTTTTCCAAGCATCCAGACACCAAGGATGCCCAACTGGCCTATGAGTGCAGTTATTTTGTGGTCATACACATTAAAGGAACCGCCTGTTGTTTTGGACAAGATATGCATAGAAAACAGTCATCGAATGTTTGCTTTGACACCTACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34027
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 2587 4318 21 33
Genomic Location (Zv9):
Chromosome 7 (position 19298714)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17800097
GRCz11 7 18052070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCCATTTTTTTTGAACATTAAGAGTTAAGAGTTGCTTTCTTTTAGTTA[T/A]GAGACAGTTGCTGCAATATTGCAGCCCTCAAGCTCTGGATCAGTCACGGA
Long Flanking Sequence:
AAGGGGCGGGATTAAACAAGATGATTAGACATTTAAAAGATGAGCGATTGCTCCATATTTTAAATTCCTTTACAGAGAGGTCATGTTTTGATCCTCGATTGGTCTCACGCAATCATATGATGCGATTTCGCATGTCAGAGTTCACCCAGTTTGAACTTTCCAACAGAGCGAACTGCGAAACTTTCCACACGACCTTACGTTTACGGTCTGACGCATTCGTGTGCATATGAATGGAACTCTATGGAAAAAGTGCAGTGTGACTGCAGCTTCACTGGCAGAGCTGTGATAAAAAAAATGAAACTCTATTGGCTGTTTTTTTTTAAAAAGGGGGAGAAACTTGAACCATCTTCAAGTTTTGGTTTAATTTACATCACACGTTGAACAAAACTGCACATTTCAAAGCACTTCATGGGACATTTATGTATGATTTTAGTTTTCACTAATATTAGTTTGCCATTTTTTTTGAACATTAAGAGTTAAGAGTTGCTTTCTTTTAGTTA[T/A]GAGACAGTTGCTGCAATATTGCAGCCCTCAAGCTCTGGATCAGTCACGGACACACTAGATGCTCTCGACAATCTTTCATCTACTGTGGATCCAGAAGAAAGCAGTTTTCCAATGGCGAGTGGATGTGACCATTCACTGGAAGAGCTCATACAGGCTGCAGAACCCGAGGTGTTTGAATCTGCCGAACCCTACATGTGGCGTTTGGTTAGTGGGCGTTCAGAAACATCACTTTCTTCAAAAGAAACTGAAAGCTGGTTTGTTGATGATGAAGCATTTTGTCTAATGAGGAAGTGGCCCCCCTTGACTGAGGCTGACCTTCATGAGATAAACAAAGTGGAGGAGGACAATACACGTGTTGAGTCACTGATACAAGAAGGTATATCTTCAGTTCTAGAGGAAGCTGGTAATGATGAGATTGTCACAGAAAGTAAAATGTTTGAGACATCGAAGGAGAAGGTGTCAGCCACAATATCTCCAGAGGAGGGGTGAGTTAATTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20891
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3379 4318 22 33
Genomic Location (Zv9):
Chromosome 7 (position 19302449)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17803832
GRCz11 7 18055805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCAACCAAATACAGATAACATTTATATTCAAACAGAAGACAATCAGTA[T/A]ACAAGTCTGCCAATCCCAGAGCCACGTGTAAAGAAACGTCTTAGTGGTAC
Long Flanking Sequence:
GTTCTAACCCCTTCGTCCACCCTTTTTTCTAAAGCTGATCCAGATAACATTGCTTTTCAAACAAAACATATTCAGGATTCAAATCTGCCAGTTCCAGTACCACGTGCAAAGAAACGTCTCAGTGATTCTTTTCCAGATGATTTTCCAACCCTTCCATACACTCTTCCATCTCAAGCAAATCCAGATAGTATTAAACCTCAAACAGAAGACAATCAGGATACAAGTCTGCCAATCCCAGAGCCATGTGTAAAGAAACATCTCAGTGGTACTTTCTCAGATGATATTACAAACCCTTCATCCGCCCCTCTGTCTGAATCAGATCCAAATAGCGCTGCAACCCAACCAGAAGACAATCAGAATTCAAATCTGCCAGTTCCAATACCACGTTCAAAGAAATGTCTCAGTGATTTTTTTCCAGGTGATCTTCCAAGCCTTTCATACACTCCTCCATCTCAACCAAATACAGATAACATTTATATTCAAACAGAAGACAATCAGTA[T/A]ACAAGTCTGCCAATCCCAGAGCCACGTGTAAAGAAACGTCTTAGTGGTACTTTCTCAGATGATATTACAAACCCTTCATACAGCCCTCTGTCTGAAGCAGATTCAGATAGCACTGTAACCCAACCAGAAGACAACCAGGATTCAAATCTGCCAGTTCCAGTACCACGTGCAAAGAAACGTCTCAGTGATTCTTTTCCAGATGAGTTTTCATCCCCACCATACACTCCTCCATCTAAAGCAGATCCAGATTGCACTGCAACCCAACCAGAAGACAATCAGAATTCAAATCTGCCAGTTCCAATACCACGTTCAAAGAAATGTCTCAGTGATTTTTTTCCAGGTGATCTTCCAAGCCTTTCATACACTCCTCCATCTCAACCAAATACAGATAACATTTATATTCAAACAGAAAACAATCAGGATACAAGTCTGCCAATCCCAGAGCCACGTGTGAAGAAACGTCTTAGTGGTACTTTCTCAGATGATGTTCCAACCCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16586
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3458 4318 22 33
Genomic Location (Zv9):
Chromosome 7 (position 19302684)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17804067
GRCz11 7 18056040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTRATTCTTTTCCAGATGASTTTTCATCCMCACCAKACACTCCTCCAWCT[A/T]AAGCAGATCCAGATTGCACTGSAACCCAACCAGAAGACAATCAGRATTCA
Long Flanking Sequence:
CAGAGCCATGTGTAAAGAAACATCTCAGTGGTACTTTCTCAGATGATATTACAAACCCTTCATCCGCCCCTCTGTCTGAATCAGATCCAAATAGCGCTGCAACCCAACCAGAAGACAATCAGAATTCAAATCTGCCAGTTCCAATACCACGTTCAAAGAAATGTCTCAGTGATTTTTTTCCAGGTGATCTTCCAAGCCTTTCATACACTCCTCCATCTCAACCAAATACAGATAACATTTATATTCAAACAGAAGACAATCAGTATACAAGTCTGCCAATCCCAGAGCCACGTGTAAAGAAACGTCTTAGTGGTACTTTCTCAGATGATATTACAAACCCTTCATACAGCCCTCTGTCTGAAGCAGATTCAGATAGCACTGTAACCCAACCAGAAGACAACCAGGATTCAAATCTGCCAGTTCCAGTACCACGTGCAAAGAAACGTCTCAGTGATTCTTTTCCAGATGAGTTTTCATCCCCACCATACACTCCTCCATCT[A/T]AAGCAGATCCAGATTGCACTGCAACCCAACCAGAAGACAATCAGAATTCAAATCTGCCAGTTCCAATACCACGTTCAAAGAAATGTCTCAGTGATTTTTTTCCAGGTGATCTTCCAAGCCTTTCATACACTCCTCCATCTCAACCAAATACAGATAACATTTATATTCAAACAGAAAACAATCAGGATACAAGTCTGCCAATCCCAGAGCCACGTGTGAAGAAACGTCTTAGTGGTACTTTCTCAGATGATGTTCCAACCCCTTCATACACTCTTCTATCTCAAGCAGATCCAGATAGCACTGCAACTCAACCAGAAGACAATCAAGACTCAAGTCTGCCAGTCGTAGTGCCACTTGTAAAGAATCGTCTCAGTGGCTGTTTCTCAGAAAATCTTCCAGCCCCTTTAACCACTCCTCTGTCCGAAGCAGATCCCGATAAAATTGCTCCACAAGCAGAATACTGTCAAGATTTAAGTCTGCAATTGACAATGCCAGTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12016
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3659 4318 22 33
Genomic Location (Zv9):
Chromosome 7 (position 19303287)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17804670
GRCz11 7 18056643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATTTCAAGAATGACAGGGACTCTAATGAAAACCTTCCAAGCTTGACT[C/T]AAGTTTCTCCCTCRATAGTCTCARAAGAAGCCAAGCTTCCTCTCTTGGAW
Long Flanking Sequence:
CAGGTGATCTTCCAAGCCTTTCATACACTCCTCCATCTCAACCAAATACAGATAACATTTATATTCAAACAGAAAACAATCAGGATACAAGTCTGCCAATCCCAGAGCCACGTGTGAAGAAACGTCTTAGTGGTACTTTCTCAGATGATGTTCCAACCCCTTCATACACTCTTCTATCTCAAGCAGATCCAGATAGCACTGCAACTCAACCAGAAGACAATCAAGACTCAAGTCTGCCAGTCGTAGTGCCACTTGTAAAGAATCGTCTCAGTGGCTGTTTCTCAGAAAATCTTCCAGCCCCTTTAACCACTCCTCTGTCCGAAGCAGATCCCGATAAAATTGCTCCACAAGCAGAATACTGTCAAGATTTAAGTCTGCAATTGACAATGCCAGTTGTAACAGGACTTCAAAGTGATTCAATTCCAGATGATACAAGTATACCCATCCCTTCTCATTTCAAGAATGACAGGGACTCTAATGAAAACCTTCCAAGCTTGACT[C/T]AAGTTTCTCCCTCGATAGTCTCAGAAGAAGCCAAGCTTCCTCTCTTGGAAAGTAAAGAATGTGCTGTTGAAGTTTCCACACAGTTGAGCACAGAAGCAGGGATAAAGAAATCAACCACCTCTGTTGCCAGTGAAGTAGAGTTAACCAGCATGTCAAACAGAAAGGGCCTGGAGGAGTCTTATTTAGATACCGTTGGGCTGGTAGACCCTGATGCGGCAGAGATCAATGAAAAACCAAAGACTGGTGATATATTTGGTGAACATAGTGAGGATGATGAGGGGAGGTATAGTGTTAAAGAAAAGGAAAGTGAAAAAGATCAAAGCATTGAAGAAAAGATGACTGCTGTATATTTTGGAGATGATGCTGTTGATTTGAGCACTGTAGATGACACAGGGGTTGTCTTAGATGTTTCTAGGTAAGTTACATGTGATTGCCTGCTGTCATATTTGCAGACATTAGCATGCAAATTAATTACTTTACAAGTGCTGTGCATGGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44652
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3757 4318 22 33
Genomic Location (Zv9):
Chromosome 7 (position 19303581)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17804964
GRCz11 7 18056937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATATATTTGGTGAACATAGTGAGGATGATGAGGGGAGGTATAGTGTT[A/T]AAGAAAAGGAAAGTGAAAAAGATCAAAGCATTGAAGAAAAGATGACTGCT
Long Flanking Sequence:
CAGCCCCTTTAACCACTCCTCTGTCCGAAGCAGATCCCGATAAAATTGCTCCACAAGCAGAATACTGTCAAGATTTAAGTCTGCAATTGACAATGCCAGTTGTAACAGGACTTCAAAGTGATTCAATTCCAGATGATACAAGTATACCCATCCCTTCTCATTTCAAGAATGACAGGGACTCTAATGAAAACCTTCCAAGCTTGACTCAAGTTTCTCCCTCGATAGTCTCAGAAGAAGCCAAGCTTCCTCTCTTGGAAAGTAAAGAATGTGCTGTTGAAGTTTCCACACAGTTGAGCACAGAAGCAGGGATAAAGAAATCAACCACCTCTGTTGCCAGTGAAGTAGAGTTAACCAGCATGTCAAACAGAAAGGGCCTGGAGGAGTCTTATTTAGATACCGTTGGGCTGGTAGACCCTGATGCGGCAGAGATCAATGAAAAACCAAAGACTGGTGATATATTTGGTGAACATAGTGAGGATGATGAGGGGAGGTATAGTGTT[A/T]AAGAAAAGGAAAGTGAAAAAGATCAAAGCATTGAAGAAAAGATGACTGCTGTATATTTTGGAGATGATGCTGTTGATTTGAGCACTGTAGATGACACAGGGGTTGTCTTAGATGTTTCTAGGTAAGTTACATGTGATTGCCTGCTGTCATATTTGCAGACATTAGCATGCAAATTAATTACTTTACAAGTGCTGTGCATGGTCATTGGAGGTGGTTGTCTTTCAGAAAAAAAATGGTGCATCTTTAATGTATGGGATTTTGGTTAATTTAGTCAGAAATGTTTAATCTTAATGTTAATATTAAGTTTTGTATTTTTATGAAAAACATCCTGTGTAAAAAATAAATGATTGTGTGATAAAAGTGAAGACATTGGTCCTTGTTTGTGTATTTTTTTGTCACTCATTGCAAAATTAAATCTGAATATCCTTGAATGCTTGCAAAAATACATCAAATTTATTTTATCAATATACCATATTTAATTAATAGCTTTTGCAGTACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8264
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3783 4318 22 33
Genomic Location (Zv9):
Chromosome 7 (position 19303660)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17805043
GRCz11 7 18057016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTGAAGAAAAGATGACTGCTGTATATTTTGGAGATGATGCTGTTGATT[T/A]GAGCACTGTAGATGACACAGGGGTTGTCTTAGATGTTTCTAGGTAAGTTA
Long Flanking Sequence:
TCTGCAATTGACAATGCCAGTTGTAACAGGACTTCAAAGTGATTCAATTCCAGATGATACAAGTATACCCATCCCTTCTCATTTCAAGAATGACAGGGACTCTAATGAAAACCTTCCAAGCTTGACTCAAGTTTCTCCCTCGATAGTCTCAGAAGAAGCCAAGCTTCCTCTCTTGGAAAGTAAAGAATGTGCTGTTGAAGTTTCCACACAGTTGAGCACAGAAGCAGGGATAAAGAAATCAACCACCTCTGTTGCCAGTGAAGTAGAGTTAACCAGCATGTCAAACAGAAAGGGCCTGGAGGAGTCTTATTTAGATACCGTTGGGCTGGTAGACCCTGATGCGGCAGAGATCAATGAAAAACCAAAGACTGGTGATATATTTGGTGAACATAGTGAGGATGATGAGGGGAGGTATAGTGTTAAAGAAAAGGAAAGTGAAAAAGATCAAAGCATTGAAGAAAAGATGACTGCTGTATATTTTGGAGATGATGCTGTTGATT[T/A]GAGCACTGTAGATGACACAGGGGTTGTCTTAGATGTTTCTAGGTAAGTTACATGTGATTGCCTGCTGTCATATTTGCAGACATTAGCATGCAAATTAATTACTTTACAAGTGCTGTGCATGGTCATTGGAGGTGGTTGTCTTTCAGAAAAAAAATGGTGCATCTTTAATGTATGGGATTTTGGTTAATTTAGTCAGAAATGTTTAATCTTAATGTTAATATTAAGTTTTGTATTTTTATGAAAAACATCCTGTGTAAAAAATAAATGATTGTGTGATAAAAGTGAAGACATTGGTCCTTGTTTGTGTATTTTTTTGTCACTCATTGCAAAATTAAATCTGAATATCCTTGAATGCTTGCAAAAATACATCAAATTTATTTTATCAATATACCATATTTAATTAATAGCTTTTGCAGTACTGTTAAATGTATTTCTTTTGTTGTGATTTATTTTATTTAGACAATCTGCAGCAGAAGATTCCCCAAGCGCTCCTGTGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1940
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Splice Site, Nonsense 3798 4318 23 33
Genomic Location (Zv9):
Chromosome 7 (position 19304121)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17805504
GRCz11 7 18057477
KASP Assay ID:
554-1928.1 (used for ordering genotyping assays)
KASP Sequence:
TTGCAGTACTGTTAAAYGTATTTCTTTTGTTGTGATTTATTTTATTTAGA[C/T]AATCTGCAGCAGAAGATTCCCCAAGCGCTCCTGTGCCAATGCCTCGCGTC
Long Flanking Sequence:
AGATGACTGCTGTATATTTTGGAGATGATGCTGTTGATTTGAGCACTGTAGATGACACAGGGGTTGTCTTAGATGTTTCTAGGTAAGTTACATGTGATTGCCTGCTGTCATATTTGCAGACATTAGCATGCAAATTAATTACTTTACAAGTGCTGTGCATGGTCATTGGAGGTGGTTGTCTTTCAGAAAAAAAATGGTGCATCTTTAATGTATGGGATTTTGGTTAATTTAGTCAGAAATGTTTAATCTTAATGTTAATATTAAGTTTTGTATTTTTATGAAAAACATCCTGTGTAAAAAATAAATGATTGTGTGATAAAAGTGAAGACATTGGTCCTTGTTTGTGTATTTTTTTGTCACTCATTGCAAAATTAAATCTGAATATCCTTGAATGCTTGCAAAAATACATCAAATTTATTTTATCAATATACCATATTTAATTAATAGCTTTTGCAGTACTGTTAAATGTATTTCTTTTGTTGTGATTTATTTTATTTAGA[C/T]AATCTGCAGCAGAAGATTCCCCAAGCGCTCCTGTGCCAATGCCTCGCGTCAAGAAACGTTTAAGTGCCTCTTTTCCAGAAGACTCCATTACCAGTTCCTCATCAGACAACCAATGTAAGGTTTCAGAAAAGTCTCTTAATGAGCCAACAGTGCCTGCTCGTAATAAACGAAGAGCTGCAGGAGATGCCATAGACCTTCAGGAAGCTTCCACAGCCCACACATCGTCAAACAGTGAAACAGAGGTGGGTGCATTTTTTATTATGTTAATTATATTATCGTAATAATAACCAGATGGTTAATTAGCTTTTTGTTTTATGCCAGATTGCGACCTTGGTGAATTCAAGTCAGTCTCTGTTGGAATGGTGCCAAAAAGTCACGCAAGGTTACAAGGGTGTGCGTATCACAAACTTCAGCACCTCGTGGAGAAACGGACTCGCTTTCTGTGCCATCCTGCATCATTTTCATCCAGAAAAACTGTGGGTGTTTTTTGAAAAAGTAAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1555
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3836 4318 23 33
Genomic Location (Zv9):
Chromosome 7 (position 19304237)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17805620
GRCz11 7 18057593
KASP Assay ID:
554-1498.1 (used for ordering genotyping assays)
KASP Sequence:
GCCTCTTTTCCAGAAGACTCCATTACCAGTTCCTCATCAGACAACCAATG[T/A]AAGGTTTCAGAAAAGTCTCTTAATGAGCCAACAGTGCCTGCKCGTAATAA
Long Flanking Sequence:
CAGACATTAGCATGCAAATTAATTACTTTACAAGTGCTGTGCATGGTCATTGGAGGTGGTTGTCTTTCAGAAAAAAAATGGTGCATCTTTAATGTATGGGATTTTGGTTAATTTAGTCAGAAATGTTTAATCTTAATGTTAATATTAAGTTTTGTATTTTTATGAAAAACATCCTGTGTAAAAAATAAATGATTGTGTGATAAAAGTGAAGACATTGGTCCTTGTTTGTGTATTTTTTTGTCACTCATTGCAAAATTAAATCTGAATATCCTTGAATGCTTGCAAAAATACATCAAATTTATTTTATCAATATACCATATTTAATTAATAGCTTTTGCAGTACTGTTAAATGTATTTCTTTTGTTGTGATTTATTTTATTTAGACAATCTGCAGCAGAAGATTCCCCAAGCGCTCCTGTGCCAATGCCTCGCGTCAAGAAACGTTTAAGTGCCTCTTTTCCAGAAGACTCCATTACCAGTTCCTCATCAGACAACCAATG[T/A]AAGGTTTCAGAAAAGTCTCTTAATGAGCCAACAGTGCCTGCTCGTAATAAACGAAGAGCTGCAGGAGATGCCATAGACCTTCAGGAAGCTTCCACAGCCCACACATCGTCAAACAGTGAAACAGAGGTGGGTGCATTTTTTATTATGTTAATTATATTATCGTAATAATAACCAGATGGTTAATTAGCTTTTTGTTTTATGCCAGATTGCGACCTTGGTGAATTCAAGTCAGTCTCTGTTGGAATGGTGCCAAAAAGTCACGCAAGGTTACAAGGGTGTGCGTATCACAAACTTCAGCACCTCGTGGAGAAACGGACTCGCTTTCTGTGCCATCCTGCATCATTTTCATCCAGAAAAACTGTGGGTGTTTTTTGAAAAAGTAATTAAAGTGATAGTTCACCCAAAAATTTAAAATTTGTGATCATTTACTCACCTTCCACTACTTGATACCAACCTGTTTGAGTTGATTTCAGCTGTTGAACAAAAAAAAGTATTTTCCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40856
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Essential Splice Site 4123 4318 26 33
Genomic Location (Zv9):
Chromosome 7 (position 19307405)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17808788
GRCz11 7 18060761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGTCTCTGGATGAGCCCGAACAACACAAACAGCAGAGCAGTGTTGAG[G/A]TAAAACTAATTTTTGACTACCCATTTTTGTAACGCAATATTCAAAGGATT
Long Flanking Sequence:
CCCGCCTGATCGAGTCCTCTGACATGGTGCTGCTGGCAGTGCCCGACAGGCTCATCGTGATGACGTATCTCAACCAGATCCGCACCTATTTCACAGGCCAGGAGCTCAGTGTCATACAGATCGAGAAGAACAGCAGCGAGTCCAGTTACGCCGTCGGTGAAAAGAGGGAAGAAGCCGATCACGAAGCCGCTGTTCGCTACTGTGCCGAAAGACTCCAGAGCAGCGGCATCACTCTAGAAACAAATGGAAATGCTCCAGAACGGGAAGCTAAAGCAGGTGCCGGAGCTATAGTGGCTCCTCCAAGAACCAAGCGAACACAGGGCTTAAACCAAACTGGTGGATCAGGAGCCGCTCAGCCTCCAGTGGCTCCACCCAGAACTCACACCTCAAAGGCTTTTTCTCATATCAAGGATGCAGATCTTGTAAAGAGACGGAGATCGAAGCTGCGGGGAGAGTCTCTGGATGAGCCCGAACAACACAAACAGCAGAGCAGTGTTGAG[G/A]TAAAACTAATTTTTGACTACCCATTTTTGTAACGCAATATTCAAAGGATTATGCTACAACATTATGTTATAAGCATAATCATCATCAAGTTTGTGAGGGTGATAATTAAAAAAAAAGATAATTGGGTAATCTATTTGGACAATTGTATAACATTAAGCTGCTGTATGTTTTTACCCAGGCTGCATCAGTCCAAGCAGAAACTGAAGCAACCAAAGGAAGCTCAGAATCACGTAAGATTTAACATTTTAATGTCTTTTTTTGCTTCAACACATTTAATTGTTGGATATAGGTAAACATTTTCTCAGCAGAGAGTAAAAAGCAATCATTTGTTTGTTGTAAACTATTGTAAAATTAATTAATTTACATGACTTGGGGGGTATTCCATAAAGCTGGGTTAACTTATCATCTGCTAAACTCCGAACTCCCAGTTGACTGAGCCAAAACCTGCTTAACATGAGTATGTCGGTTCCAAAACAGCTGAGAAGAGTTAGTTAAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11356
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Splice Site, Nonsense 4141 4318 27 33
Genomic Location (Zv9):
Chromosome 7 (position 19307635)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17809018
GRCz11 7 18060991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CWGCATCAGTCCAAGCAGAAACTGAAGCAACCAAAGGAAGCYCAGAATCA[C/T]GTAAGATTTAACATTTTAATGTCNNTTTTTGCTTCAACACATTTRATTGT
Long Flanking Sequence:
ACTCTAGAAACAAATGGAAATGCTCCAGAACGGGAAGCTAAAGCAGGTGCCGGAGCTATAGTGGCTCCTCCAAGAACCAAGCGAACACAGGGCTTAAACCAAACTGGTGGATCAGGAGCCGCTCAGCCTCCAGTGGCTCCACCCAGAACTCACACCTCAAAGGCTTTTTCTCATATCAAGGATGCAGATCTTGTAAAGAGACGGAGATCGAAGCTGCGGGGAGAGTCTCTGGATGAGCCCGAACAACACAAACAGCAGAGCAGTGTTGAGGTAAAACTAATTTTTGACTACCCATTTTTGTAACGCAATATTCAAAGGATTATGCTACAACATTATGTTATAAGCATAATCATCATCAAGTTTGTGAGGGTGATAATTAAAAAAAAAGATAATTGGGTAATCTATTTGGACAATTGTATAACATTAAGCTGCTGTATGTTTTTACCCAGGCTGCATCAGTCCAAGCAGAAACTGAAGCAACCAAAGGAAGCTCAGAATCA[C/T]GTAAGATTTAACATTTTAATGTCTTTTTTTGCTTCAACACATTTAATTGTTGGATATAGGTAAACATTTTCTCAGCAGAGAGTAAAAAGCAATCATTTGTTTGTTGTAAACTATTGTAAAATTAATTAATTTACATGACTTGGGGGGTATTCCATAAAGCTGGGTTAACTTATCATCTGCTAAACTCCGAACTCCCAGTTGACTGAGCCAAAACCTGCTTAACATGAGTATGTCGGTTCCAAAACAGCTGAGAAGAGTTAGTTAAATCAATCTCCTGAAGATAACCGCGGGTTAATGTGCGTGCATGGCGCATACCTGAAGACATTTTCAGTAGATCGCCGAGAGAATGCCACAATGAGAAAAAAGGGCAACGCACTTTACAGAGGTGAAGCTGGAGGTTTTAATGCTGGCGTACAAGGCATTAAGGTCAATTATAAAGAAAAAGCAATACACATCTGAAGGAAAGAAATATAACATAATAAATAGATAAGAAAAGAAAA
Associated Phenotype:
Not determined