Busch Lab

ZMP

ENSDARG00000057305

Ensembl ID:
ENSDARG00000057305
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11461 Nonsense Available for shipment Available now
sa29318 Nonsense Mutation detected in F1 DNA Not yet available
sa12705 Nonsense Available for shipment Available now
sa9497 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 4 643 1 2
Genomic Location (Zv9):
Chromosome 20 (position 12912105)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13101351
GRCz11 20 12997331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCCTTCATTTTCAGGAAAGGTGGTACAAAGAATATCCATGGCTTCATTA[T/G]AGCCCCACAGTTAAGGGAATTCTCTGTTTTCACTGTGTGAAAATATATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29318
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 113 643 2 2
Genomic Location (Zv9):
Chromosome 20 (position 12912452)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13101698
GRCz11 20 12997678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGCAGGGTTTGGCACTGCGTGGTCATGACAAAGAAGATGGTAACCTTT[T/A]GCAATATTTAAAAAATAAAGCGAAGGATGACGCCTGTCTTTCTGACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12705
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 436 643 2 2
Genomic Location (Zv9):
Chromosome 20 (position 12913420)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13102666
GRCz11 20 12998646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ARTCAACTCTCCAGTTCAAAAGGAACRAAGAAAGATTTCAGGAGATTTTT[A/T]AAAAAGCARTGAAAATGGTGGACTCTCTTGGCATTGAACCCATTCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9497
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 436 643 2 2
Genomic Location (Zv9):
Chromosome 20 (position 12913420)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13102666
GRCz11 20 12998646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ARTCAACTCTCCAGTTCAAAAGGAACRAAGAAAGATTTCAGGAGATTTTT[A/T]AAAAAGCARTGAAAATGGTGGACTCTCTTGGCATTGAACCCATTCAGATG
Associated Phenotype:
Not determined