Busch Lab

ZMP

galnt7

Ensembl ID:
ENSDARG00000057303
ZFIN ID:
ZDB-GENE-050522-284
Description:
N-acetylgalactosaminyltransferase 7 [Source:RefSeq peptide;Acc:NP_001018477]
Human Orthologue:
GALNT7
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) [Sour
Mouse Orthologue:
Galnt7
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7 Gene [Source:MGI

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39648 Nonsense Mutation detected in F1 DNA Not yet available
sa30802 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1202 Essential Splice Site F2 line generated Not yet available
sa6596 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa757
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Nonsense 3 652 1 12
ENSDART00000114903 Nonsense 3 652 1 13
ENSDART00000135666 None None 211 None 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38552431)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37423887
GRCz11 1 38143065
KASP Assay ID:
554-0664.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTTCTGTTTTCTTATTTTTCAACTGATTTCCTNCCCCCAAAATGAGGT[T/G]AAAGGTTGGATTCATCCTTCGAAGTTTGCTGGTCATCGGCACATTTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39648
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Nonsense 19 652 1 12
ENSDART00000114903 Nonsense 19 652 1 13
ENSDART00000135666 None None 211 None 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38552479)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37423935
GRCz11 1 38143113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAGGTTGGATTCATCCTTCGAAGTTTGCTGGTCATCGGCACATTTT[T/A]GGGGCTGGTTTTGCTTTGGTCTTCTTTGACACCGAAGGCTGGAGACGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30802
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Essential Splice Site 42 652 None 12
ENSDART00000114903 Essential Splice Site 42 652 None 13
ENSDART00000135666 None None 211 None 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38552551)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37424007
GRCz11 1 38143185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTGACACCGAAGGCTGGAGACGATAACCCGTTTGCTGGTGTAATGG[T/A]AAGCTAGGATGGTCGTTAGTTACCTTGACACGTTATTGTTTTCGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1202
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 None None 652 None 12
ENSDART00000114903 Essential Splice Site 378 652 6 13
ENSDART00000135666 Essential Splice Site 132 211 3 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38565964)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37437420
GRCz11 1 38156598
KASP Assay ID:
554-1111.1 (used for ordering genotyping assays)
KASP Sequence:
TGGGTAGCAAGGAGAAGCAGAAGAGACTAACTAGAACTGAGCCCTATCGG[T/A]AATTTAAAGCCATAATCCTGAGCTGATTAGGGCTGACCACAACACGCATA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6596
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Nonsense 392 652 7 12
ENSDART00000114903 Nonsense 392 652 7 13
ENSDART00000135666 Nonsense 146 211 4 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38569156)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37440612
GRCz11 1 38159790
KASP Assay ID:
554-4885.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTCAGGTCTCCTGCCATGGCTGGAKGGCTGTTTGCAATTGAGAGA[G/T]AATTCTTCTTTGAGYTGGGTCTTTATGATCCAGGCCTTCARATCTGGGGA
Associated Phenotype:
Not determined