Busch Lab

ZMP

iqca1

Ensembl ID:
ENSDARG00000057276
ZFIN ID:
ZDB-GENE-050208-768
Description:
IQ motif containing with AAA domain 1 [Source:RefSeq peptide;Acc:NP_001092201]
Human Orthologue:
IQCA1
Human Description:
IQ motif containing with AAA domain 1 [Source:HGNC Symbol;Acc:26195]
Mouse Orthologue:
4931409K22Rik
Mouse Description:
RIKEN cDNA 4931409K22 gene Gene [Source:MGI Symbol;Acc:MGI:3045319]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20676 Nonsense Available for shipment Available now
sa40659 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104681 Nonsense 75 471 2 11
ENSDART00000127133 Nonsense 75 630 2 15
ENSDART00000128939 Nonsense 75 406 2 8
Genomic Location (Zv9):
Chromosome 6 (position 15668843)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15642075
GRCz11 6 15769015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGTTTACGATCAGATTGTTCACCCCCAGAAGAGACGTGTCGTGCAC[C/T]AGGTTCTTGACGGAGTGATGGGACGATTGGTAGAGCTGAAGAATGAGATG
Long Flanking Sequence:
TTGCTAACTGTCACATATGTGCATTCATAAGAGACTGCCTTTTGGGCAGATATCAACACAACAGTTATTGTCACATTATTTATTTTGTATAACTGTATAAGTATATTTGTATGTAAAATATGTATGCATAGATATATGTTTTTATATTTAAAGTCTACATATGTGGATTGTTTGATATTGACCTATTATCATTTCCTGCAAGTAAATACTCATCACGTAATATTTATTTAAAACTTGAAGACTAAAATATTATCACATAAATATACATTAATCTAATTTCTTTCCCCAGTTCATATGGCCGAATGTTGGATGCTGCTCAGGGAGCTTTGGAAGACCTTTTGGAGGATGAATATCCCACATTGGAGCTCCGTCCTCAAAAGGACCGCCTGCAGGTGTTTCAAACACTGGCCACTTTCTTCCTACGCTACATGAAGATTTTCCGTGCCCTGGAGGAGGTTTACGATCAGATTGTTCACCCCCAGAAGAGACGTGTCGTGCAC[C/T]AGGTTCTTGACGGAGTGATGGGACGATTGGTAGAGCTGAAGAATGAGATGGTGGAGCTGGAGCACTCTGAATTTCACTACTTTGATGACCTATTGCAAGACTTTAAAATGACACCTGTGAGTGAGATAAGAAAATGTACTGTTTTGTGCTGGGAATTTTTAGGTCTGACGTGCTTTTAAATTCACAAGAGTGAGCCTAAAGGAAATGTTGGAGATTTTGGGCTTGGGGAAGATTTAAGTGCTCAATGTCAAAGTGGATTTTAGCAAGCTAAGACTGAATTTAGAGAATGCTAATTGGGGTCACTAGTGCACTACCACTTTTACTCTTTTCTACTCTTTTCTGTTCTGCTCTTTTAATTTTTTCATCTTGCTTTTTAGGAGGATCTTGAGGTGCCTATTCCACGTTATTTTGTGAGAGAAAAGATGAGGGCGTTGAAGGAGAGGGAGAAGATGCTGGCCCATGTTTTGGCTAAAGAAGGACGTCCAGAACACAAATCTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2333
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104681 Nonsense 86 471 2 11
ENSDART00000127133 Nonsense 86 630 2 15
ENSDART00000128939 Nonsense 86 406 2 8
Genomic Location (Zv9):
Chromosome 6 (position 15668876)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15642108
GRCz11 6 15769048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGACGTGTCGTGCACCAGGTTCTTGACGGRGTGATGGGACGATTGGTA[G/T]AGCWGAAGAATGAGATGGTGGAGCTGGAGCACTCTGAATTTCACTAYTTT
Long Flanking Sequence:
ACTGCCTTTTGGGCAGATATCAACACAACAGTTATTGTCACATTATTTATTTTGTATAACTGTATAAGTATATTTGTATGTAAAATATGTATGCATAGATATATGTTTTTATATTTAAAGTCTACATATGTGGATTGTTTGATATTGACCTATTATCATTTCCTGCAAGTAAATACTCATCACGTAATATTTATTTAAAACTTGAAGACTAAAATATTATCACATAAATATACATTAATCTAATTTCTTTCCCCAGTTCATATGGCCGAATGTTGGATGCTGCTCAGGGAGCTTTGGAAGACCTTTTGGAGGATGAATATCCCACATTGGAGCTCCGTCCTCAAAAGGACCGCCTGCAGGTGTTTCAAACACTGGCCACTTTCTTCCTACGCTACATGAAGATTTTCCGTGCCCTGGAGGAGGTTTACGATCAGATTGTTCACCCCCAGAAGAGACGTGTCGTGCACCAGGTTCTTGACGGAGTGATGGGACGATTGGTA[G/T]AGCTGAAGAATGAGATGGTGGAGCTGGAGCACTCTGAATTTCACTACTTTGATGACCTATTGCAAGACTTTAAAATGACACCTGTGAGTGAGATAAGAAAATGTACTGTTTTGTGCTGGGAATTTTTAGGTCTGACGTGCTTTTAAATTCACAAGAGTGAGCCTAAAGGAAATGTTGGAGATTTTGGGCTTGGGGAAGATTTAAGTGCTCAATGTCAAAGTGGATTTTAGCAAGCTAAGACTGAATTTAGAGAATGCTAATTGGGGTCACTAGTGCACTACCACTTTTACTCTTTTCTACTCTTTTCTGTTCTGCTCTTTTAATTTTTTCATCTTGCTTTTTAGGAGGATCTTGAGGTGCCTATTCCACGTTATTTTGTGAGAGAAAAGATGAGGGCGTTGAAGGAGAGGGAGAAGATGCTGGCCCATGTTTTGGCTAAAGAAGGACGTCCAGAACACAAATCTGTGAATGTATGTTCATAAAAAACCATAGTGGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40659
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104681 Nonsense 145 471 3 11
ENSDART00000127133 Nonsense 145 630 3 15
ENSDART00000128939 Nonsense 145 406 3 8
Genomic Location (Zv9):
Chromosome 6 (position 15669314)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15642546
GRCz11 6 15769486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGAGGGCGTTGAAGGAGAGGGAGAAGATGCTGGCCCATGTTTTGGCT[A/T]AAGAAGGACGTCCAGAACACAAATCTGTGAATGTATGTTCATAAAAAACC
Long Flanking Sequence:
TTCACCCCCAGAAGAGACGTGTCGTGCACCAGGTTCTTGACGGAGTGATGGGACGATTGGTAGAGCTGAAGAATGAGATGGTGGAGCTGGAGCACTCTGAATTTCACTACTTTGATGACCTATTGCAAGACTTTAAAATGACACCTGTGAGTGAGATAAGAAAATGTACTGTTTTGTGCTGGGAATTTTTAGGTCTGACGTGCTTTTAAATTCACAAGAGTGAGCCTAAAGGAAATGTTGGAGATTTTGGGCTTGGGGAAGATTTAAGTGCTCAATGTCAAAGTGGATTTTAGCAAGCTAAGACTGAATTTAGAGAATGCTAATTGGGGTCACTAGTGCACTACCACTTTTACTCTTTTCTACTCTTTTCTGTTCTGCTCTTTTAATTTTTTCATCTTGCTTTTTAGGAGGATCTTGAGGTGCCTATTCCACGTTATTTTGTGAGAGAAAAGATGAGGGCGTTGAAGGAGAGGGAGAAGATGCTGGCCCATGTTTTGGCT[A/T]AAGAAGGACGTCCAGAACACAAATCTGTGAATGTATGTTCATAAAAAACCATAGTGGTCAATTAACTCAAATCAAACATTAGAGAAAAGCAAATCCCCTAACAAAAGTCCAGTAAAAATAGTAAGTACTTTTTTACAATTTCAGAGTGAATGTACAAATTCACTTTTATGTACTTACACAAGCATTGTAAGTAAATTAAAAGTAAAAAGTAAACTTATGCAAATAAATAAAAATAAACCCAATAAGTCCACAACTTAAGCAACTGTACAGGTCAGGTGTCCAAAGTCGCTTTGGGAAAGTTTACCCCAACTCTAATTAAACAGGTCTGTGACAGCTAATTAAATTCTAATGCTATGGTCACACTATAGTTTAAGCATTCAAAATTTTGTCCTACAGTGCTGCGAAAAGGGGCGGGATTAAAGAAGCTCATTAGACATAAAAAAGCGAATGATTTCTGTCCAAAATTTCTTAACTTTGCAATGCAATGAACTGCTAAATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7034
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104681 Nonsense 297 471 6 11
ENSDART00000127133 Nonsense 297 630 6 15
ENSDART00000128939 Nonsense 297 406 6 8
Genomic Location (Zv9):
Chromosome 6 (position 15680919)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15654151
GRCz11 6 15781091
KASP Assay ID:
554-4427.1 (used for ordering genotyping assays)
KASP Sequence:
AGTCAGTGCGGRCTGTGGATGGGGCAGATATTAAAGAAAGCCTGCAAGAA[C/T]AAATACGCCAGTGGTTTCTKGAGTGTCGGTAAGCCATGCACAAAATYATY
Long Flanking Sequence:
ATTCTCAATTTTTCACAGGTTGTAGATGCAAGAGTAGTGAAGATACCAAGTGTAACAATGCAAGAACATATGCAGTTTTTTTGTATTTGGCAGCATTATGAGTATTTGCAGCATGTGGGGTCAAACTGATGAAAAACGCTTTCCTGCCAGTTTTTTTTTTTTTTCTTTTGCATACATTTTCATCAGCTGCAGTGCATTGAGGTTTCTAAGTCATAACAGAAAGCAGTGTCATCTAAACATGCCCTTAATCAAACCACATGCTGAATGTTTTTGTGCTGTAAGTTGTCAGTTTTTCCATCTCTTGTGACCTGGTGTCCTGTTTCCAGATTCCAGCCCAGCAGCAGACACCCAGCCCTGCCCAACTTCGTGCCCAGCAGGTGGAACGCAGGAGACACATCATTCAGGAGGAGCATGAGGCTGAGTACCAGACAGCACTGGTCAACATCAAAGAGTCAGTGCGGGCTGTGGATGGGGCAGATATTAAAGAAAGCCTGCAAGAA[C/T]AAATACGCCAGTGGTTTCTTGAGTGTCGGTAAGCCATGCACAAAATTATTAAAAATATATACAGTGCCTGACAAAAGTCTTGTCGCCTAAGTTTTAGGAACAACAAATAATAACTTAATTTGGTAACAGAAGTGGCTTAAATAAAAGGCAAAAACCTCTAGATTACACTTATTTTACCAAAATAAAATTTGATCATGCCTTTATTTTTAAATATTTTATTAGGTCAGCAAGGTCTGACTTTGCTTAGGCAAATGTCTTGTCACTTAACAGAAATAATGTACAGTATAGAATATAAAGTCATGGTGCAGTGGAAAAAGAGTTATTTATTATATTGTTTATGACTCCCATGAGCTTGAATGACATCTCTGCAATGACTCAAACATCATTAATAAAGTCATCTGGAATGACAAAGAAAGTGTTCATGCAGGACTCCCAGAGTTTATCAAGATTTTTCTTGTCTGGTGATGGGGCTGGCCAATCCTGGAGCACCTTGAACTTCA
Associated Phenotype:
Not determined