Busch Lab

ZMP

si:dkey-194n13.2

Ensembl ID:
ENSDARG00000057273
ZFIN ID:
ZDB-GENE-090311-47
Description:
Novel protein similar to vertebrate arachidonate 5-lipoxygenase (ALOX5) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
ALOX5
Human Description:
arachidonate 5-lipoxygenase [Source:HGNC Symbol;Acc:435]
Mouse Orthologue:
Alox5
Mouse Description:
arachidonate 5-lipoxygenase Gene [Source:MGI Symbol;Acc:MGI:87999]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22263 Nonsense Available for shipment Available now
sa12277 Essential Splice Site Available for shipment Available now
sa42170 Nonsense Mutation detected in F1 DNA Not yet available
sa1464 Nonsense Available for shipment Available now
sa35451 Nonsense Mutation detected in F1 DNA Not yet available
sa17538 Essential Splice Site Available for shipment Available now
sa6291 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22263
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Nonsense 53 674 2 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18216870)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18036905
GRCz11 13 18167897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAAATTGAATTTTAAAAGCATTTGGCATTTTGTGATTCAAGGTGGACT[C/A]ATATGACATCAGCGTAGGAGAGGATCTTGGTGAAATTCAGCTGGTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12277
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Essential Splice Site 117 674 3 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18216598)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18036633
GRCz11 13 18167625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TARTACAGCATTCAATTTTAGTATAACATTTGGATGCTTGTTGKGTTTCA[G/A]CTCGATTGCCACAGCACGACAAGACCGGAGTGGCGAAACAGCACAGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42170
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Nonsense 140 674 3 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18216529)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18036564
GRCz11 13 18167556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGACCGGAGTGGCGAAACAGCACAGGCGCAAAGAACTGGAACAGAGA[C/T]AGAAGACATACAGGTTTGATGCAACTTTTAAAATAAGGTCAACCACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Nonsense 201 674 5 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18196746)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18016781
GRCz11 13 18147773
KASP Assay ID:
554-1389.1 (used for ordering genotyping assays)
KASP Sequence:
TAGGATCGAGAATCTGTATGTGAACCAGTTCATGCACATGTTCCAGTCCT[C/A]ATGGGGAGATTTCGCAGACTTTGAGCGGATATTTGTGAGAATTAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35451
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Nonsense 235 674 6 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18194250)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18014285
GRCz11 13 18145277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGAATATGTGATGGAGCACTGGAAAGAAGACTTCATGTTTGGATA[T/G]CAATACTTAAACGGCTGTAATCCAGTGGTCATCAAAAAATGCACTGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Essential Splice Site 328 674 8 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18191124)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18011159
GRCz11 13 18142151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAAATTATTACTGATGAGTTCTGAAAATGATCRTGATTTCTTTTACRT[A/G]GCTGCATCAGWAACCAGGAGAGGACAATCCCATCTTCCTTCCCAGTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6291
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079884 Nonsense 331 674 8 14

The following transcripts of ENSDARG00000057273 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18191113)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18011148
GRCz11 13 18142140
KASP Assay ID:
554-5407.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGATGAGTTCTGAAAATGATCRTGATTTCTTTTACATAGCTGCATCAG[A/T]AACCAGGAGAGGACAATCCCATCTTCCTTCCCAGTGACGATGAGTAYGAC
Associated Phenotype:
Not determined