Busch Lab

ZMP

zmynd11

Ensembl ID:
ENSDARG00000057249
ZFIN ID:
ZDB-GENE-050522-301
Description:
zinc finger, MYND domain containing 11 isoform 2 [Source:RefSeq peptide;Acc:NP_001071051]
Human Orthologue:
ZMYND11
Human Description:
zinc finger, MYND domain containing 11 [Source:HGNC Symbol;Acc:16966]
Mouse Orthologue:
Zmynd11
Mouse Description:
zinc finger, MYND domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1913755]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44159 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6776 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30114
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105768 Essential Splice Site 166 640 None 17

The following transcripts of ENSDARG00000057249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28109604)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27160191
GRCz11 24 27239350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGATGTGGTTAATGAGTCATTTGTTTTTTGTGATGATATTTACTAAC[A/G]GGGCAGTAAAAGGAAGAATTTGAACAAACAGGAAATGACAACATACCTGA
Long Flanking Sequence:
TTCGCGGCTACGAATACATCATTACATGAAGACAGTAATGACATTTTTGGGTGAATTATACCTTATTAATACAGTACATGACTCTTTAAACACCATTTGGAGGTGTCCATGTTGCTGATCAATGTATATAAATCAATGTGAAGACTTGTGCAACCGCCTTGATGCTTCTCTCCTGACGGTGAAAATATAAATGGCTGAATCTTAGAAAAAGCAGAATAAAGATTGTGTGTAGGGTCGAATCGAGATCGCAATCTTATTTTGATTAATAGTGCAGCCCTAACAAACATCCGACCAAATAATGTAGAATAGATTTGTGTCATGCTGACAATGAAAGGTCAAACAACTACTCACCCATATGAAATCCTCAGGAATGTAAATTGAAGTATTTCACAAACATGCTTTTAATTTATTCGTTTGAAACCTTAAACCATTGTGAGAGTAATTTAGTGCAGATGATGTGGTTAATGAGTCATTTGTTTTTTGTGATGATATTTACTAAC[A/G]GGGCAGTAAAAGGAAGAATTTGAACAAACAGGAAATGACAACATACCTGAAGTTCATTCTTGGACGCATGAAGGAAAGGGTGCGTTTCACACTTTTACGTCACACTTAATCGTCTGCGTATTTTCTGTTAAAATAAAAAAGTGAAACAGATTTAGATGTTGTCTTCTAATCTGATCTTGATAGGCTGTAGACCTGCACAAGAGAGGCAAAGAGGCAAAGCAGCCCATATACAAAAGACTGATCCACACGCCTCTGGATGTGGAAAACATACAAGAGGTAAAAACGAATTAAAAAATAAAGATCTCCCAGCGGTTTTGGCATGTTCTTATGTTTATTTTCCTCTACAGAACATCTCAGATGGGAAGTACAAGAGCTTTGAGGAGTTCAGGGCTGATGCTCAACTTATAGTTCACAACACCGCCATTCTGCACGGAGGTGAGGTTTAAAACTGGTGTGATTTATAAATAAAACACTGTGGAGCAAGGTGTCAACCGTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44159
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105768 Essential Splice Site 222 640 8 17

The following transcripts of ENSDARG00000057249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28109327)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27159914
GRCz11 24 27239073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATACAAAAGACTGATCCACACGCCTCTGGATGTGGAAAACATACAAGAG[G/A]TAAAAACGAATTAAAAAATAAAGATCTCCCAGCGGTTTTGGCATGTTCTT
Long Flanking Sequence:
TAACAAACATCCGACCAAATAATGTAGAATAGATTTGTGTCATGCTGACAATGAAAGGTCAAACAACTACTCACCCATATGAAATCCTCAGGAATGTAAATTGAAGTATTTCACAAACATGCTTTTAATTTATTCGTTTGAAACCTTAAACCATTGTGAGAGTAATTTAGTGCAGATGATGTGGTTAATGAGTCATTTGTTTTTTGTGATGATATTTACTAACAGGGCAGTAAAAGGAAGAATTTGAACAAACAGGAAATGACAACATACCTGAAGTTCATTCTTGGACGCATGAAGGAAAGGGTGCGTTTCACACTTTTACGTCACACTTAATCGTCTGCGTATTTTCTGTTAAAATAAAAAAGTGAAACAGATTTAGATGTTGTCTTCTAATCTGATCTTGATAGGCTGTAGACCTGCACAAGAGAGGCAAAGAGGCAAAGCAGCCCATATACAAAAGACTGATCCACACGCCTCTGGATGTGGAAAACATACAAGAG[G/A]TAAAAACGAATTAAAAAATAAAGATCTCCCAGCGGTTTTGGCATGTTCTTATGTTTATTTTCCTCTACAGAACATCTCAGATGGGAAGTACAAGAGCTTTGAGGAGTTCAGGGCTGATGCTCAACTTATAGTTCACAACACCGCCATTCTGCACGGAGGTGAGGTTTAAAACTGGTGTGATTTATAAATAAAACACTGTGGAGCAAGGTGTCAACCGTTTCCTCATTCTCTGTCAACAGTCAACAGCGATCAGACTGAAATTGCGAGACTTCTCTATAACGACACATGCCATGAGGTCAGAAAGAGCAACACTTGTTGAGTGCTTTTCCTTCTAGATTTATGTTAATATATAAATTATATGTTCCAGCTGAATGAGTTAATGCTGTGCAGAACCTGCTTTTATCTCTCAAATGCGCGACCTGACAATTGGTTCTGCTACCCATGTGTAAGCACAGATCCAGACACTTAATTCTTCACGTCTACGCCTGTTGTTTTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6776
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105768 Nonsense 407 640 13 17

The following transcripts of ENSDARG00000057249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28106819)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27157406
GRCz11 24 27236565
KASP Assay ID:
554-5020.1 (used for ordering genotyping assays)
KASP Sequence:
ACGACAGGTCAGAGAGGCACGAAAGGCAGGAAGAACGACAGGAAGAAGCY[G/T]AGTCAAGCATCTCGTCCACATCCAATGAGCAGGTGAGCACTTTTCTGYTG
Long Flanking Sequence:
GACAATTTAATTCTTTTTATAATCCAAATATTAATTTTGATGTTTAATGCAAGTTAGAATTGCTTGTTAAGATCTTAAATCTAAAGTTAGATGAATGTTTGAAATGTTACTTAAATATCTGATCATATTTACACAATAGGTGACTACTGTACATATGCTGTTAGAAGTCAAAAGTTTGTGAAGTTATTGTATTGCCCAACGCTACTGAGTTTTGACTCTCCTTAATTGTAGACCTGGACCAAAAGCTTAATGTGAGCACACTAACAAGCTTGTGTCTGTTTTGCTGTAGGGCATGGATTCCTTCTGACAACATCCAGGACATCACGGTCAGTGTGCAGCAGCTGCAGGTAAAGCGCAGCTCAGGCTGGAAAAAGGCCTGCGATGAGCTGGAGCTCCACCAGCGCTTTGTGAGGGAGGGCAGAACCTGGAAGGGCAAACCGGAGGAAAAGAACGACAGGTCAGAGAGGCACGAAAGGCAGGAAGAACGACAGGAAGAAGCC[G/T]AGTCAAGCATCTCGTCCACATCCAATGAGCAGGTGAGCACTTTTCTGCTGCATGGAAAATGTCACTGTTCACCTTTCAAGACTTTATTGAACATCCTTCTGAATTTTGCAACAGTCTAGAGTCAACCAAGAGCCCAAGGCTAAAAAGAGCCGTCGTTCCCAAGTCGCCGAGCCCAAAGAAGAGGTTTGTACCACATAATTATTTTTAAAATATATATGTTGGACCTATTTACTCTGGCTGACGTCATGTGTTTTCTCTGATCAGATAGCGATCTGATTTATGAAAATGGTTCCATTTACATTTGGCTACATACAGTAAATGCGCCTCTGCTAAACGGATACGATTCTGAACCTTAAATCCAGAACCCTAGACAAATTCAATGAGGTGATGTTGACTAAAGCATCAGATACAGCGTGATTTATTTCAATAATATATTAGTTTTTACAGAAACTTACTTTATCTTATTCAGCATACGAATGATTTTATATATTGGCTATAGG
Associated Phenotype:
Not determined