Busch Lab

ZMP

si:dkey-30k6.5

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23908 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29567
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079850 Nonsense 232 515 2 3
ENSDART00000144366 Nonsense 448 757 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19222620)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20358109
GRCz11 21 20394745
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGATGCAGAGCAGTCGAAACGCTCTACAATTGTCCCGTCTGTGACAAA[C/T]AGTTTAAGATCAAACAGAACATGCTGGATCACCAAACGCTGCACACCGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7957
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079850 Nonsense 350 515 2 3
ENSDART00000144366 Nonsense 566 757 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19222976)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20358465
GRCz11 21 20395101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAAAACTTTACGGTTGTCCGATATGCTTAAAGAGGTACACGACTGCGTA[C/A]GCTCTAAAAATGCACACACACAAACATACTTCAAGCAAACCTTTYCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23908
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079850 Essential Splice Site 423 515 3 3
ENSDART00000144366 None 647 757 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19223219)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20358708
GRCz11 21 20395344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACATACAGGAGAGAAGCATCATGAAAGACTGATCAGTCCTCTGCTGAA[G/A]AAGTTTGCTTGCGATCATTGTCAAAAGAAGTTCTACTCACAAGCCGCACT
Associated Phenotype:
Not determined