Busch Lab

ZMP

rorca

Ensembl ID:
ENSDARG00000057231
ZFIN ID:
ZDB-GENE-990415-250
Description:
RAR-related orphan receptor C a [Source:RefSeq peptide;Acc:NP_001076288]
Human Orthologue:
RORB
Human Description:
RAR-related orphan receptor B [Source:HGNC Symbol;Acc:10259]
Mouse Orthologue:
Rorb
Mouse Description:
RAR-related orphan receptor beta Gene [Source:MGI Symbol;Acc:MGI:1343464]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27166
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079840 Essential Splice Site 271 479 5 10
ENSDART00000100484 Essential Splice Site 271 480 4 9
Genomic Location (Zv9):
Chromosome 8 (position 19413982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18858620
GRCz11 8 18889037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCCTGGACCCTCTACACACCTGAAGAGATCCGTGTCTACCAAAACAAG[G/T]TAACTGAGATGCATCATGCTTTATAATAACATGTAACAGGTGTAACGGCA
Associated Phenotype:
Not determined