Busch Lab

ZMP

efna5b

Ensembl ID:
ENSDARG00000057223
ZFIN ID:
ZDB-GENE-980526-186
Description:
Ephrin-A5b [Source:UniProtKB/Swiss-Prot;Acc:P79728]
Human Orthologue:
EFNA5
Human Description:
ephrin-A5 [Source:HGNC Symbol;Acc:3225]
Mouse Orthologue:
Efna5
Mouse Description:
ephrin A5 Gene [Source:MGI Symbol;Acc:MGI:107444]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21172 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27121
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101574 Nonsense 78 187 1 4
Genomic Location (Zv9):
Chromosome 8 (position 1460049)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1377484
GRCz11 KN148038.2 9989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAATCGCCCTCATTCGCCCAACGGGCCGCTCAAGTTCTCGGAGAAATTT[C/T]AGCTTTTTACACCCTTTTCTCTGGGCTTCGAGTTCAGGCCCGGACGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21172
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101574 Nonsense 161 187 4 4
Genomic Location (Zv9):
Chromosome 8 (position 1480001)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1397436
GRCz11 8 1445494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTCAGACGACACGAGTCATGAGGCTGAACCATCCCGGAGCGACGTGT[C/A]GACTTCAGGCCTGCGGCACCAGACGTCGCGCCCCCTGCTGGCGCTCCTGC
Associated Phenotype:
Not determined