Busch Lab

ZMP

has3

Ensembl ID:
ENSDARG00000057210
ZFIN ID:
ZDB-GENE-021118-1
Description:
hyaluronan synthase 3 [Source:RefSeq peptide;Acc:NP_775327]
Human Orthologue:
HAS3
Human Description:
hyaluronan synthase 3 [Source:HGNC Symbol;Acc:4820]
Mouse Orthologue:
Has3
Mouse Description:
hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36614 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36614
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079817 Essential Splice Site 213 555 2 3
Genomic Location (Zv9):
Chromosome 18 (position 16688979)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17040745
GRCz11 18 17029811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTAGTGAGGAAGTCTTCCAAGTAAGTATCTCTTGCTTTGTTTGTTTGC[A/G]GGTATGTGATTCAGACACTGTACTTGATCCAGCATGCACTATTGAGATGT
Associated Phenotype:
Not determined