Busch Lab

ZMP

ngfr

Ensembl ID:
ENSDARG00000057143
ZFIN ID:
ZDB-GENE-030131-2537
Human Orthologues:
LTBR, TNFRSF11A, TNFRSF4
Human Descriptions:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
tumor necrosis factor receptor superfamily, member 11a, NFKB activator [Source:HGNC Symbol;Acc:11908
tumor necrosis factor receptor superfamily, member 4 [Source:HGNC Symbol;Acc:11918]
Mouse Orthologues:
Ltbr, Tnfrsf11a, Tnfrsf4
Mouse Descriptions:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]
tumor necrosis factor receptor superfamily, member 11a Gene [Source:MGI Symbol;Acc:MGI:1314891]
tumor necrosis factor receptor superfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:104512]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39087 Nonsense Mutation detected in F1 DNA Not yet available
sa9547 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28618
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022685 Nonsense 81 413 3 6
Genomic Location (Zv9):
Chromosome 16 (position 18378629)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16419866
GRCz11 16 16327843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTTTTCAGACTCTGAGAGTCTTTTATCCTGTACGCTATGTGCCCATTG[C/A]CCCATCGGTATTCCTCAGCTGGCACGCTGCACCAAAACACAGGATACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39087
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022685 Nonsense 376 413 6 6
Genomic Location (Zv9):
Chromosome 16 (position 18368978)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16410215
GRCz11 16 16318192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGTCTTTGGACGGGGCCAGGACCCCATCCACACCCTCATGACCGATT[G/A]GTCCCAGCAGGAAGGCTCCACATTGGGTTTGTTGTGTTCAGCTCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9547
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022685 Nonsense 376 413 6 6
Genomic Location (Zv9):
Chromosome 16 (position 18368977)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16410214
GRCz11 16 16318191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACGTCTTTGGACGGGGCCAGGACCCCAWCCACACCCTCATGACCGATTG[G/A]TCCCAGCAGGAAGGCTCCACATTGGGTTTGTTGTGTTCAGCTCTGACTCG
Associated Phenotype:
Not determined