Busch Lab

ZMP

hadha

Ensembl ID:
ENSDARG00000057128
ZFIN ID:
ZDB-GENE-031222-5
Description:
hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase, alph
Human Orthologue:
HADHA
Human Description:
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), a
Mouse Orthologue:
Hadha
Mouse Description:
hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trif

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31050 Nonsense Mutation detected in F1 DNA Not yet available
sa414 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29461
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079734 Nonsense 31 761 2 20
ENSDART00000126238 Nonsense 11 741 1 19
Genomic Location (Zv9):
Chromosome 20 (position 48625901)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48525993
GRCz11 20 47955715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTATGTTTTGGGTCGTAGGTCATGGACAGAGATCTCTCTCCGTATCAT[C/A]GGCTGTGCTGGGTAACTATTAAAACAGAACAAAGGATACGGATTATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31050
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079734 Nonsense 256 761 8 20
ENSDART00000126238 Nonsense 236 741 7 19
Genomic Location (Zv9):
Chromosome 20 (position 48634577)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48534669
GRCz11 20 47964391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGTGGCTGTTGATTTTGCTAAAGGTCTCGCTGCTAAAAAAGTCACCT[T/A]GGAAAAGAAGAAAGGGCTCATGCAGAGTAAGACAAACACATCAGCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa414
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079734 Nonsense 638 761 18 20
ENSDART00000126238 Nonsense 618 741 17 19
Genomic Location (Zv9):
Chromosome 20 (position 48653279)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48553371
GRCz11 20 47983093
KASP Assay ID:
554-0274.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTATCTGCACTTCAGGACGCAAGTCTGGAAAGGGTTGTTATGTGTAC[G/T]GAGCCAAGTCAAAAGAAAAGAAAGTGAACTCAGAAGCTGAAGAAATTCTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461