Busch Lab

ZMP

si:dkey-83f6.3

Ensembl ID:
ENSDARG00000057125
ZFIN ID:
ZDB-GENE-091117-48
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JRG3]
Human Orthologue:
PLD1
Human Description:
phospholipase D1, phosphatidylcholine-specific [Source:HGNC Symbol;Acc:9067]
Mouse Orthologue:
Pld1
Mouse Description:
phospholipase D1 Gene [Source:MGI Symbol;Acc:MGI:109585]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6775 Nonsense Mutation detected in F1 DNA Not yet available
sa14680 Nonsense Available for shipment Available now
sa1311 Nonsense Available for shipment Available now
sa37906 Nonsense Available for shipment Available now
sa44158 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6775
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 65 1042 2 25
ENSDART00000124580 Nonsense 61 359 2 9
Genomic Location (Zv9):
Chromosome 24 (position 27509109)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26570399
GRCz11 24 26712428
KASP Assay ID:
554-5164.1 (used for ordering genotyping assays)
KASP Sequence:
CAGACTCCCGCATCCCCTTYTCAGCTGTATATAAAACCAAAGGCTTTAAA[G/T]AGCCCGGTGCGCGWGTGTTTCTCACMGCGCTCCCCATCACCGCCAAAATC
Long Flanking Sequence:
ACAGTTCAAAACAAGCACCCTAAACAATTAATCCAAAATATTTTAGCCAAACTCTGAGTACACCTTCTCAGCATCCATATCTGACACTTTGCTACAATAAGCAGAAGGGGGAGTCATCAAGATCTACCTGAGCTAAAACTCCCCTCTCGCCTTGCAACGGGAGGGCGCCCAGGGCTTGAGGATCTTATAAGCTCAGGGCTCTCTCCCGGGACAGCACGCCAAACTAGCTTTATTATCAATCATCAGCTAAGTGTGAACTGTTGAAACTACATTTAAATGTGAATTTGGAAGAAATGTTATCAGACCTTTATACTATAAAACTAATGTTAACCTTTTACTCAAACCTATATCTGAGAAGTCCAATAAACTTAGAAGACCTGATCTCTTAGTGGATTTTTTCCGTAGCTCTACATTGAACTTGTCAGTCACTAACATGAAGCATTTGGTCCGCAGACTCCCGCATCCCCTTTTCAGCTGTATATAAAACCAAAGGCTTTAAA[G/T]AGCCCGGTGCGCGTGTGTTTCTCACAGCGCTCCCCATCACCGCCAAAATCCTGGAGGTGGAGCGATTCACGTCAGCGCAGGACCGCTTCAACATCACGGCCCAGAGGAGCGTCTCGAAGGTGAGAAATCCCACTGCCGCTGCCTTCAACAAGTGAGAGTTGTGGGCTGAACGCCTTTTATTTGTTGCCCGGGAGATTTCGAGGTTGCCAAGGCAATTTACATGTTGCCCTGGAGATTTGGACACTATATATGAAAATATTTAGCACATGCAAAATAGTTTTTCAGAAGAATAATGACAAAAGGCGCTGTTATTGAATCTGACGAGCAATCGCTGATTGTGTTTTGGGTGTCGTTTATTGAAGGTTTCTATATATGAAATCTATGAAATGAAAATTTAAATTGTGTGTTTTACTTTCATGTTGTTCCAATTTTTTGTTTTGTTTAGAAAATGATAAATGTCACAATAAATAAACAAGTGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14680
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 259 1042 7 25
ENSDART00000124580 Nonsense 255 359 7 9
Genomic Location (Zv9):
Chromosome 24 (position 27502746)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26564132
GRCz11 24 26706065
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTATTCCTGGACTGAACTGCTGTGGCCACAGCAAAATGTGCTACCGCTG[G/A]TCCAAACGGTCAGTTTTATTTTCTAAAAGAACAAAAATAAWTGTGTTTGA
Long Flanking Sequence:
AGTCTGCATTTAATGAATTTATTTATTTTTTGAATGAAAGCATCTGGCTACAATTTTGTTTATATTTTTTCCTCAAGAAAAAAATCTGTGCTCAGTTAAAATATGAATTATTATTCATGCATGTCTGTTTAAAGAGGAATCTACTATTTTGTAAAAACTGCTGAAGATGGCAATATCTAAGATTTGACTCAGATTTAAGCGGGATAAAAATGACTTGTGGAATATGGCTGCATCATTATGTTTTACAAAATTCTACAAAATAATGGATTACTTTGTTAGTATACATCCATGACATTTAATATTTTGTTTCACAATCAAAAATTTGAATCAGGGTTTTATATAGAATGACCTGAATATATTTATAGGTATATTCTTGTATTTCTTTTGTAATCAATGTTTTCCTGTTTCCATTTCAGGGAGGGCATGGTCCACAAAAGGTCCGGTGGTCACCGTATTCCTGGACTGAACTGCTGTGGCCACAGCAAAATGTGCTACCGCTG[G/A]TCCAAACGGTCAGTTTTATTTTCTAAAAGAACAAAAATAATTGTGTTTGACTCACTATGGTTAAAACGACTAGAGCCGATTATGAACAAAACCTCTCATCTTGTACTATATTTTCCAAAATAGAAGTAATTTTTTTATCATCTGAAACCTGCTGTGACTAATAGTCCACGCAAAGGATAATGTGCATCCAGCTTGTTATCATTGAAAGTTATAAAGTTCAATAAACAAAAGAAAAACAGTGTCCTATAAGTGGATGACTAATAACAGTGCAGTGATTGTCAAAATACCTGTTCATCAACTTATTTTTCAATAAACGTGTTCGTAATACAGCTAGCTCTCTGCAACTCTCACATGGTTGCCCTCTGAAGCTAAGTAGGGCTGCGCCCGGTCAGTACCTATATGGGAAACCACATGAGAAAGCTAGGTTGCTGCTGGAGGTTATGTTAGTGAGGCCAGCAAGGGGCGCTCAACCTGTGGTCTGTGTGGGTCCTAATGCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1311
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 356 1042 9 25
ENSDART00000124580 Nonsense 352 359 9 9
Genomic Location (Zv9):
Chromosome 24 (position 27501504)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26562836
GRCz11 24 26704823
KASP Assay ID:
554-1226.1 (used for ordering genotyping assays)
KASP Sequence:
ACGGCAGCAACTTCCTTAAAGATCATCGCTTCGGGTCCTTCGCCAATGAA[C/T]AGAAGAACATCCTRTCTAAATGGTAAATATCACTTTTTACATGCATTCCC
Long Flanking Sequence:
CTGGTGGTGGATGAAGAGATTCCCCCCAAAAATATGTAAAACGCTTTGAGTGTCCAGAAAAGTGCTATATAAATGTAAGGAATTATTATTCTATTAATTAATATATTACTGTTGCTCTTTATAGGTGGATGGTGGCGAAGGACTCTTGCCTGCTCCTCATGAAGCCAGATTCTGGTGCCATCTCATTCGTCCTGCTGGTGGATAAAGAGTTTGACATTAAAATGGACACTAAAGACACTGAAACGAAGCATGGTGTTCGCATTGACAGTCTATCAAGGTGTGTGGACATTGGTCATTTAAGATACCATGTAATATGCTGTTTACTTGCACATTCATTGTAGGGTAAAGTGAAAGAGCTTTATGCTTCTTAAAGGACTCTGGTGCTGAAGTTTACGAGTTACCGTCATGCCCGCTGGTGGGGACAAGCCGTTGATGATTTTGTGCGCAAATACGGCAGCAACTTCCTTAAAGATCATCGCTTCGGGTCCTTCGCCAATGAA[C/T]AGAAGAACATCCTATCTAAATGGTAAATATCACTTTTTACATGCATTCCCCGACTAAAATGATCAAATCATAGGGGTGGCCATATGTTACCCCAGAACACAATAGCAAATATTATAATACAAATAAAATATACAGTATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATAGCACAATCGCCTCACAGCAAGAAGGTCGCCGGTTCGAGCCCCAGCTGGGTCAGTTGGCGTTTCTGTGTGGAGTTTTCATGTACCCCCTGTGTTCGCGCGGGTTTCCTCCGAGTGCTCCAGTTTCCCCCACAAGTCCTAAGACATGCGGTACAAGTGAATTGGGTAGGCTAAATTGTCCGTAGTGTATGTGTGTGTGTGGATGTTTCCCAGAGATGGGCTGAAGCTGAAAGGGCATCCGCTGCTTAAAATATATGCAGGGTAAGTTGGCGGTTCATTCTGCTGTGGCGAACCCAGATTAATAAAGTG
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control on top; Mutant below; 48 hpf
Control on top; Mutant below; 48 hpf
Stage Entity Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
heart contraction
GO:0060047

decreased rate
PATO:0000911
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
larval locomotory behavior
GO:0008345

absent
PATO:0000462
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
curved
PATO:0000406
abnormal
PATO:0000460

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4273
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Essential Splice Site 391 1042 10 25
ENSDART00000124580 None None 359 None 9
Genomic Location (Zv9):
Chromosome 24 (position 27498047)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26558326
GRCz11 24 26701467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAATGCGCTGGAGGAGGCAGAGGAGGAGATCTTCATCACCGACTGGTGG[T/A]ATGTTCTGATAAAACCTTCTTTTGGTACTATTGATTCAGGGTAGAATTAT
Long Flanking Sequence:
ATTTGTTGACAAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAAGGACCCAGTGCTTAAAATCTGACCGTTTCACATTTTAATTGCAGTGCAGTTCTTGCTGTTTCTCACCTTTCGCTATTGTGACCAAAATATATTGCTTAATTTAACCAAGATCATTTCAAAGGAGTCTTAGACTGGTCTGAGCCATAAAATGCATGTGCTCAGATAGCAAGGAACAAATTGGGATCAAACAGGTTAAAATAACAAATAAAATCCATGTCATGACCCCTTTTAGAGTGCAAGATTTGAGTATTAAGCTTGTTTGGCTGTGTGTGTAAATGCATGTGTGTGTTTTAGGTATGTGAATGGGAAGCAGTACATGGAGGACGTGGCTAATGCGCTGGAGGAGGCAGAGGAGGAGATCTTCATCACCGACTGGTGG[T/A]ATGTTCTGATAAAACCTTCTTTTGGTACTATTGATTCAGGGTAGAATTATTAAACAGATCACATGACTCCATTGGTTAATGTTTTGACTTTAAAACATCTTCTAAATTCTAAAATAATCAATAGACTTTCCAGTTCTGGTTAATGCTGTGTGTTTGTATTCTGGAGGGTTTCTTGGAAACAAAAAACCACAGAGATCATACTGTACAGGTCCCAACCTGGCATCCCACTACAAGAACTGCAGTTTATCCAAGCATATCTATTGTTTTACATCAGTGAAATTTCAGTGTTTATGGGGTGATTATCAGCACCCATAAAAATCTAAAAATGTTAGTGAATATAAAGAATAAGGATAAATGATATTTTTGTATTGTTATACTTTGTATTTAATTTTTAGAATTATGTTTAGTGTATGTTTCGGTCATTAGTATTAGTGTTGTTGTTATATATTTGTATATGTGTTTTTTTTTAGAACATCAAAAAAATCTGAATGAAAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 638 1042 16 25
ENSDART00000124580 None None 359 None 9
Genomic Location (Zv9):
Chromosome 24 (position 27485225)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26545555
GRCz11 24 26688696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGTGATTTTGTTTTCTATAATATGATTTTTTTGTAGATTTTATTGAT[C/T]GACACATTACTCCCAGAATGCCTTGGCATGACATTGCTTCTGTGGTTCAT
Long Flanking Sequence:
ATTTTGTGCCTTTTGTTGTTTTTTTTATTATTATCATTATTGTCTGTGTTCCCCCCTCTACAGAGTCCGAAGCAACACAGGATTTGCAAGCAGATGTGATTGGCCTGATGGGAAACACGCGGTTCTGGCATGGCAAAGACTACTGCAACTTTGTGCATAAAGACTGGATCCAGCTGGATAAACCTTTTGATGGTGAGTCATTATATTTAAAGTAAAATTAAGCCTTTTTGCTGTTATTATTAAAGCATTTAATGTTTTGTTTTTATTATATTTTATTAATATACATATAATACAAATGAATAGAATATAATAGATAGAAATAAATTTTATTAAATTATTACTTTTCATTAATTAATAAAAGTATAAATGCAGTTTGCAAAAAATATGATTTCAGACTTTTAGCATTTAAAAAAGCCCATTTAAATACATTTTTACATTTATGTTGGTTCAATGAGTGATTTTGTTTTCTATAATATGATTTTTTTGTAGATTTTATTGAT[C/T]GACACATTACTCCCAGAATGCCTTGGCATGACATTGCTTCTGTGGTTCATGGGCAAGCAGCCAGAGATGTTGCACGCCACTTCATTCAGCGCTGGAATTTCACAAAGGTCAGTATTCACTTAATATTGAACAATATCTTGTTTCTCAAAAATTTTTAATCTATGAATGTTAAACAAAATTGTGCATTATTTTTACACTTTTATACACTGACATCCATTTTAAAAGTACAGATATTGCACTTAGTCTTTTAATCCTCATTATATATTCAAAATCTTTAGTTCTTTTTTTAGTGTTCAGATCTGGCTTTAATTTGTTATTGTGATGTCGATTGTTATTATAAAAAATCTCATCAGTATTAAATATTATAATGTTTTTTTCATGTATTTACATAATTGAGAAATTATTTGAACATTTTGGATGAATTACACAAAAGAGAGAATATTTTTTTTAGAAAATTTTTTGAGAGAATATTTTGAGAATATTTTAAGAATATTTTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44158
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 714 1042 18 25
ENSDART00000124580 None None 359 None 9
Genomic Location (Zv9):
Chromosome 24 (position 27484091)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26544421
GRCz11 24 26687562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCACATTCAGCTTTCAAAATATCAGTTCTCTCTTTGCTCAGGTTTTG[C/T]GATCCGCCTCAGACTGGTCAGCGGGTATAAAATACCACGAGGAGTCGATT
Long Flanking Sequence:
TTGATGCCGCCAGTAGTTTGCTAGTTGTATTTTGAACACATTTTCAAGTTTTATTCCCTTACTAAAACCTGTGCATTTTTAATCATCATTTTAATGTATTTTCCAGATCACAAATGTGTTATGAGTATTAATATGTAATCAGAGTCACTTACTTAATTAAATTGTAATTTGTTTCAGATCAATTATAACCAATAAAACATTTTATGTCAACCCCTGTGCTGTTGACAAAAATCATAAATCTTACTTTAAATGTACAATATGTTCATATTTACATTTCTGTCATGTTTCAGATCATGAAGCCTAAATACAGGTCTCTGTCGTACCCATACCTCCTTCCTAAATCTCACACTACAGCGAATGAGATCAAGTATCAAGTCCCTGGCTGCACACAGACCAATGTCCAGGTACAAACACATCAAAACATCAATATACTCTCATAGGATCAAGCAAATATCACATTCAGCTTTCAAAATATCAGTTCTCTCTTTGCTCAGGTTTTG[C/T]GATCCGCCTCAGACTGGTCAGCGGGTATAAAATACCACGAGGAGTCGATTCACACTGCTTACGTCAATGCAATTGAACACAGCCAACACTATATCTACATAGAGGTCTCTAATTTTCCCTCTTATATGTTTGTGTATATTGCTTTCATCTAATAGACTGTTATACAGTATAATAGACTAACATACTGTTGTTGTGTTGGTTACTAAATACAGAGACTGAGGTTTTTGTATCTGCAGTGTAATTAAAAATATGTAAGGAATAATTGATGACCGGCAAAGTTATTATACATTAGTTCATAATTGTCCTAAGAGAAGAATGGATGTTGTTCAATAGATTTAGGAAAACTTTGTTGAAAGGTTTTGATCCACTTCAAATGTTGACCACTGTAGTTTTGGGTTAAATACAGCATTTTTAAATTTGTTTTTAACTTAATACTATTTTAAATTGTGCCATGAATTTCAGTGTAGATTTACTTAGTTTTATTAATGTTTTTGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5079
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 786 1042 20 25
ENSDART00000124580 None None 359 None 9
Genomic Location (Zv9):
Chromosome 24 (position 27480436)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26541060
GRCz11 24 26684201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCTGTGTGTGTGTGTGNNNNNNGTTGGCAGGGATGGTAAAAAGTWCCGTGTGTA[T/A]GTGGTGACGCCGCTGCTGCCTGGGTTTGAGGGTGACATTAACACTGGAGG
Long Flanking Sequence:
TTATTATTATTATTCATTTGAACAAATAAAATTTAATATTTAACTTATTTTTTTGTTGTGTTACATTTTCTCCTAGAAAGGAGGTAAATGTAACTATAAATATGTTGTATAGCAGCCTTTCAGTGGATTAATATTTGATTTCTCTTTCAGAATCAGTTCTTCATAAGCTGCGCAGACAGCAAAGTCGTTCACAATAGAATTGGAGACGCCATTGCCAAGAGGATCATAAAAGCCTACCGGTGACTTTCTGCCTCTTAATAATTATCTTTTGTAAAATCCACACACCTCTGATATACAGATTCTTTAATCTAGCATTTGTAAATCAATAGGAGATAGAGACAAGAGTTTGTTTAAAGACAAATAGGAGTAGCTAAACATTAATGTATGAATAGATGGATTGTGTAAGGTCATATTTGCACAAATGTCTATCATATTAATGTATAATCTTGTGTTCTGTGTGTGTGTGTGGTTGGCAGGGATGGTAAAAAGTACCGTGTGTA[T/A]GTGGTGACGCCGCTGCTGCCTGGGTTTGAGGGTGACATTAACACTGGAGGAGGCAGCGCCATACAGGCTGTCATGCACTTCAATTACAGGTAATGTAAAATAGGGGATAGTTTGTCACAAAATTAACATGCACTCTGTTGTTTGATTCCCTCAAGTTCCCTCAAGGTTCCCTCAAGTTCCAATCAACTTATTCTGATCTGTACTCATGCAAATATTTCAATAATTATATAATTTTGTAAATGAATAAAAACTATTGTTACATGAGTTTAATGTTTGTCTTCTCTAAATCAGGCTAAAAATATTTCATGTACAGTACAAACTATAAAGCTTGATATAAACTTTTAGCTTATATAAAATTTTTATTTTGATGCTTGAAAACCCCTTTTATATTTGAAGCATAAACTGCCTCAGAAGTTTAAAGAAATATAATAAAACATTCAAGCAAAGGATGTATTCAATTTATTCAATTTGCTACAAATTTGTTAGCTTTCTGTTTCTCA
Associated Phenotype:
Not determined