Busch Lab

ZMP

dnajc21

Ensembl ID:
ENSDARG00000057080
ZFIN ID:
ZDB-GENE-030131-8928
Description:
DnaJ homolog subfamily C member 21 [Source:UniProtKB/Swiss-Prot;Acc:Q6PGY5]
Human Orthologue:
DNAJC21
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 21 [Source:HGNC Symbol;Acc:27030]
Mouse Orthologue:
Dnajc21
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 21 Gene [Source:MGI Symbol;Acc:MGI:1925371]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37242 Nonsense Available for shipment Available now
sa25150 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37242
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079674 Nonsense 248 545 5 12
Genomic Location (Zv9):
Chromosome 21 (position 9124670)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11096960
GRCz11 21 11189588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGAAGGCCAAGAAAGTGGAAGAACTGAGGAGAAAACAGAAGCTCAGC[C/T]AGGCCAAGTATGTGAGATTACATTGGTTTGAACTATTTAGTGCATACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25150
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079674 Nonsense 255 545 6 12
Genomic Location (Zv9):
Chromosome 21 (position 9123583)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11095873
GRCz11 21 11188501
KASP Assay ID:
554-7399.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTATGCTGTATATTTATTGATCATTATGTTAGGCTTGCTGAAGACTA[T/A]CAGGAGCAGAGCTGGACTGCAATGTCTGAGCTGGAGAAGGAGCTGCAGCA
Associated Phenotype:
Not determined