Busch Lab

ZMP

rpgrb

Ensembl ID:
ENSDARG00000057074
ZFIN IDs:
ZDB-GENE-081015-2, ZDB-GENE-081015-2
Description:
Retinitis pigmentosa GTPase regulator protein 2 ORF15 [Source:UniProtKB/TrEMBL;Acc:D2X899]
Human Orthologue:
RPGR
Human Description:
retinitis pigmentosa GTPase regulator [Source:HGNC Symbol;Acc:10295]
Mouse Orthologue:
Rpgr
Mouse Description:
retinitis pigmentosa GTPase regulator Gene [Source:MGI Symbol;Acc:MGI:1344037]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa21936 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21936
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088624 Nonsense 33 1413 2 14
ENSDART00000124471 Nonsense 33 708 2 17
Genomic Location (Zv9):
Chromosome 11 (position 30648420)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29524406
GRCz11 11 29771580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTTTGGAAAGAGTAAATTTGCAGACAACGCCCCTAGTAAATTCTGGT[T/A]AAAAAATGATGTACCTTTGCGAATTTCCTGTGGAGATGAGCACACAGCAC
Long Flanking Sequence:
TATCTGTTTATAATTAGCCGTCAAGCTATAACGGTGCTACACAGCGAGGAGCATATGTTAGGATGTAAACATTGGTTAACTGCGTTCATATCATAAAAATATTGTCATTTATATGATTTAAAAGTTTTAATTGCAGCTTGTGTGTTGTATTTTGTCGCCGAACACTCTGTCCCGCTTTATTCCATTGACGCTTGTGGCTACCTGTCGTCAAGGCAACCACACCATGTGGTCACGCCTCTGGTTTACTGTATAATATTTTATAAACAATTAATTTGAGCTATCTGATTATGCATATGTACGGTAACGTCAGCTTAATATTGTACTAATTATTATTCATTTACAACATAGCATAACATTGCATTGTCATAGCTTTTTTGACAATCACAAACCTGAATAACATTCTCTGTTGCTCTGTATTTCTGTTTTTGTTTTAGAGTCCGGAGCTGTCTTCACTTTTGGAAAGAGTAAATTTGCAGACAACGCCCCTAGTAAATTCTGGT[T/A]AAAAAATGATGTACCTTTGCGAATTTCCTGTGGAGATGAGCACACAGCACTAGTCACAGGTATGGTTTATGATTTTACTGGTGAATATTTTGTCTTGGTGCATAATTTTACTGTATGTGTTTATCTTGTCACTATCCCTGTTGTGTTTTTTTTTAGAGAATGGGAAGCTGTTTATGTTTGGCAGCAATAACTGGGGACAGCTGGGCCTCGGAACAAAGACCACTGTGAATAAACCCACTTGTGTAAAAGGTACAACACTACATGACAGACTGTCAAAGTGAGAGCACTGAGTGTTCCCTGCCTTTCACAGCTGATAAATGACAGCTAATACCATTGACAATGCTGTGACAAAAAGGAGGTCTTTTTTAAGGTTGCTGTTAATCCCAGTGTGGAGTGGTCCATAATCTGCATTAATCTGGTTAGAGCAGGGGAAGTAGTGTGTGTGCCTTTAGAATACAATATTTCAGCATTTTTACAAATAAGATTGTTAAATATAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7671
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088624 Nonsense 394 1413 10 14
ENSDART00000124471 Nonsense 394 708 10 17
Genomic Location (Zv9):
Chromosome 11 (position 30657954)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29533940
GRCz11 11 29781114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WCTTAGAGGAGGATGACKYCACTGAAGACTACCTTGAGAAGTCTTATACT[G/T]AATTACTGGGGGACACACACAGTCAGACCACCCTAAACAGGAGTCTCTCA
Long Flanking Sequence:
AGCCCTGTATAATTCTAAAATTTCATTTATAATGGCCTTAAAAGGGTTGACACATTTGACTTAATGAAACCTGCAGAAATCCTGAGATTAACCCTGACATGCACATTGTATGTGTAATGTTACAAAAAACCCTTATAAACAGCACAACTGTTCTCAACATATATGATATTAATAATAAATGTTTATGAGCATCAAAGCACCATATTAAAATGACTTTTAAAGGATCATGTGACGCAAAAACATGTATGTACAATATTTATTTTTATTAAATATTAAGCCATGTTAAATGGTCATGGTGAGCTTCGACTTTTAAATAATAGAGCAAACTGTATATTAATGTTATGACATCTATAAACAATCTGTAAACGGTGTGTGTTTTTCAGGTTACTTGTGGTGGGTGTCACATGCTTGTTTTGGCAAAGCCCAGAACTGAAAGACCAGATGACTTAATCTTAGAGGAGGATGACGTCACTGAAGACTACCTTGAGAAGTCTTATACT[G/T]AATTACTGGGGGACACACACAGTCAGACCACCCTAAACAGGAGTCTCTCAGCTCGGGTCAGACGCAGAGAAAGGGTGAGTCAGTCATAAAGGATCAAAATAAATGTAGCCAGTTAGAATTTTTTGAGTAATGGTGCTGTATTTCTAGAATAATATAATTAATTGACTAGTTGTAGTGTAATTCATTTTCTAGACTAATTAAATACATTTAAATGTTAAGTTTAGTGCAATAACTCAATAATATATTATAAAAAAAAAAATTGTGTCGTTTTTTTCACTTCAGGAACGTTCACCAGATCAGTTTGGACAGATGTTTCGAACACTTCCAGCACTGAGTGGGAATCAGAGTGCATCTCTATCTGTTCCCAGCCAGATACGTCCCTCCAGCAAGCAACTTGGAAAGATTCCTCACAATAGCCTTAAAAGTACTATTATCTGTTTTAATAATCCTCCATGGATTTGTGTTCATTGTAGTTCAAATGTTTGGGGTCAATATGATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6213
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088624 Essential Splice Site 465 1413 11 14
ENSDART00000124471 Essential Splice Site 465 708 11 17
Genomic Location (Zv9):
Chromosome 11 (position 30658379)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29534365
GRCz11 11 29781539
KASP Assay ID:
554-4973.1 (used for ordering genotyping assays)
KASP Sequence:
ACGTCCCTCCAGCAAGCAACTTGGAAAGATTCCTCACAAYAGCCTTAAAA[G/A]TACTATTATCTKTTTTAAYAATCCTCCATGGATTTGTGTTCATTGTAGTT
Long Flanking Sequence:
AGAACTGAAAGACCAGATGACTTAATCTTAGAGGAGGATGACGTCACTGAAGACTACCTTGAGAAGTCTTATACTGAATTACTGGGGGACACACACAGTCAGACCACCCTAAACAGGAGTCTCTCAGCTCGGGTCAGACGCAGAGAAAGGGTGAGTCAGTCATAAAGGATCAAAATAAATGTAGCCAGTTAGAATTTTTTGAGTAATGGTGCTGTATTTCTAGAATAATATAATTAATTGACTAGTTGTAGTGTAATTCATTTTCTAGACTAATTAAATACATTTAAATGTTAAGTTTAGTGCAATAACTCAATAATATATTATAAAAAAAAAAATTGTGTCGTTTTTTTCACTTCAGGAACGTTCACCAGATCAGTTTGGACAGATGTTTCGAACACTTCCAGCACTGAGTGGGAATCAGAGTGCATCTCTATCTGTTCCCAGCCAGATACGTCCCTCCAGCAAGCAACTTGGAAAGATTCCTCACAATAGCCTTAAAA[G/A]TACTATTATCTGTTTTAATAATCCTCCATGGATTTGTGTTCATTGTAGTTCAAATGTTTGGGGTCAATATGATTTTTAAGAGAGAAAAAGTCACATCAAACTGATTAAAACAGACTGAAAAGACCTTTACATTGATGCATAATATGCAGCTATAACTTCGGTATTGAAAATTATTAAGATGGTTGCTGATATCGACCGTTAAAATACAAAGCATTTATTTAAAATTGTAATAATATTTTGCTATATTACATTGGAGACAAATTTCAACAGTATTGTATTAATTATTCATGTTTTAAATCTCCTCTTTCAATAAGCTCCTGGAATTAGAGCGAAGTCTTTTGATGACAGAAGCAGTGTGGAGGATAGCGAGAGTGTAAAAGACCTTGGAGAAACCACTGACTTATTAAACCTGGTAGGAGAATCATACATCACTTATTAAAGCAATGTACATGCTTTCATAATGTCTATAGAAAGTATGTAGAGTTAGATTGGTTTATTGG
Associated Phenotype:
Not determined