Busch Lab

ZMP

enpep

Ensembl ID:
ENSDARG00000057064
ZFIN ID:
ZDB-GENE-050309-218
Description:
Novel protein similar to glutamyl aminopeptidase (Aminopeptidase A) (ENPEP) [Source:UniProtKB/TrEMBL
Human Orthologue:
ENPEP
Human Description:
glutamyl aminopeptidase (aminopeptidase A) [Source:HGNC Symbol;Acc:3355]
Mouse Orthologue:
Enpep
Mouse Description:
glutamyl aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:106645]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa31910 Nonsense Available for shipment Available now
sa42155 Nonsense Mutation detected in F1 DNA Not yet available
sa10319 Nonsense Available for shipment Available now
sa2718 Essential Splice Site F2 line generated Not yet available
sa5788 Essential Splice Site F2 line generated Not yet available
sa35436 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 148 951 1 20
Genomic Location (Zv9):
Chromosome 13 (position 12450103)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12448471
GRCz11 13 12580946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGCCTTCACTACAGCGCAGCAGCCCGTCTGGTGTGACCTCTGTCAAGT[T/A]GAAGCAATGCTTTGAATACAAGCCGCAGGAGTACGTGGTTGTGGAAGCGG
Long Flanking Sequence:
GAGTGTTCTGACTTGGTGAACTTTGAGTGTTTGTACACATTTCTGACTTCGAGACAGCATGGAAAGCCTGGACTTCGAGAAGAAGGAAAAGCGGTACTGTATCCGAGGAAAGCACGCTGCTATCATCTGTGCCGTCATCGTAGTGACAGGTGTAGCTGTGGGACTTGGAGTTGGCTTAAGCTTGAATTCTTCATCCGAAAAGGAAACACCATTACCAACTCCATTACCCACAGAAGTGCCTGATGATCGCCCATGCAAACCATCTGAGAACACCAATGGCGGCTGGAGCAATTTCCGATTACCTGACTACATTCTTCCGTTCCATTACGATCTGCATATGGAGCCTGACCTCAACACGGACATCTACACTGGGGACGTGTCTGTACATCTGAAACTGACTCAGCCCAGTCAGCACCTGTGGCTCCACATCCGGGACACTTTTGTCACTGTGATGCCTTCACTACAGCGCAGCAGCCCGTCTGGTGTGACCTCTGTCAAGT[T/A]GAAGCAATGCTTTGAATACAAGCCGCAGGAGTACGTGGTTGTGGAAGCGGCTGAGCAGTTGAGCGTTACAGGGCCGGATGAACACTACGTCCTCACTCTGCACTTCCAGGGCTGGTTAAATGGCTCTCTGGTTGGCTTCTACAGGACCACGTATCAGGAGAATGGAGTTACCAAGTAAGCACTTAAAAACATCTGTTTTGTATGAATGCATTTCAGTTGGGTTATTAGATGGCAGGTGGCACGGGGGCTCAGTGGTTTGCACTGTCACCTCACAGTAAGAAGGTTGCCAGTTTGAATTCCGGCTGGACCAATTGGCATTTCTGTGAGGAGTTTGGATGTTCTCCCTGTGTTCACGTGGGTTTCTTCTTCATGCTCTGACTTCCTTCACGGTCCAAAGACATGCGCTGTAGGTAAATTGAATAAACTAAAACTGGCCGTAGTGTACGAGTGTGTATGTAATAAAGTATGGGTGTTTCCCATTACTGGGTTGCAACTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42155
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 493 951 8 20
Genomic Location (Zv9):
Chromosome 13 (position 12426075)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12424443
GRCz11 13 12556918
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCGAATGCTGGAGGACTTACTTGGCCGAGAGACATTTAGGGATGGTTG[T/A]CGAGTAAGGCATCTCACATTTTAACCTACTTTTTCCAGTGGCTCTGTATT
Long Flanking Sequence:
CATTAAAGGCACCGTCAACAGAAACAGCTACATTGTGTTTAGAGCAGAAAATTTTATATTCTAAAAGGTATAATAAATAATCTGGAAGGGGTTTTGAGCTGAAACTTTACAGACAAGTTCTGGAGACACGAAAGACTTTACTTAAATCTTGAAAAAGGAGTAAAATAGGTGCCCTTTAAATCAAGATGTTATGTTATACCCACATCACTCTGTTTTTTTTAGCGTGACGTCATGCTTATCAACGATGTATATCCTGTCATGGTCGATGATGCCCTTCTCTCCTCGCATCCCATTATTGTGGATGTGTCGAGCCCAGCTGAGATCACATCTGTGTTTGATGCCATCTCATATAACAAGGTAAGGTAAAGTTAGTGATGGTTGGTGTTGATCTATCAAATGTATTTGCTTTGAATAGTTGCTCTGATCTTATTGTTTTAGGGAGCTTCTATTTTGCGAATGCTGGAGGACTTACTTGGCCGAGAGACATTTAGGGATGGTTG[T/A]CGAGTAAGGCATCTCACATTTTAACCTACTTTTTCCAGTGGCTCTGTATTTATATCTCACTTCTGTTTTACCACAGAGATATCTGAAGACCTACCTCTTCCAGAACGCAAAGACTTCAGACTTCTGGAAAGCCTTGGCTGATGTAAAAACCCATTTTAATGTTTTTGGAGTCTTTTTTATTTATTATTGTTCACTTTTCTCTTAGATTATTTTGTTCCCAATGTAATCTACAGTGCTCAACATATATAAGTACACCCTTCCCAAATCTCTCTTTTAAATTCTTAATTTTAATAGGAAGCTATACACTATTATATTTGTGCATATATATTGGATTAGTCAGTACTGAAGCCAAATCTGGAGCTAATCTAGCAAAATAACTTACGAAAATGGTCCATAAACTAGTACAGCCAAATTTATGTTTTAGAAAAATATTAAATACAATTTATTTAAAAAAAAAGAGGACAAATCAAGAGAAGCAAAAAAAAAAAAAAAAAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4494
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 688 951 14 20
Genomic Location (Zv9):
Chromosome 13 (position 12419356)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12417724
GRCz11 13 12550199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAATTTAACAAGATATCTGGCYGAYGAAACCGARTATATTGTGTGGGAT[C/T]GAGTTTCTGCTTCTATCTCCTACGTGAGAGAAATGTTGGCTGATGATACA
Long Flanking Sequence:
TGGGCACCCCTGCTATAAGCATGCTAGCCATCTGTTAAAATGTGCTAGAAATGTGTTATTTTCTGCTAGAAGCTTATTAAACTTGCTACATCATAAACAAGCTATCAACAAGCGAGTTTATTCTAGAAATGCACTAACAGAAAAGAAGCCACAGCCGAAGAGAAAATGATTGAATGAATGTTATTTTCCTAGGTCTACGATGCAACTGACAGAAGCAGCTACATTGATGATATATTCGCATTAGGACGGTGAGTGCAAACATTTTCTAACCCCATTGAGCTTGTGTTTTTAATATCAACTTGATGACAGGCGAAAAATTGAGTTTACATAGCACAGCTTTTTATGGTTAAAGTGGTGGAGGTCAGAAAGTGAGGAAGATGAAGTCATGCTTAAAGTGGCGCCTTTTGTTTTGCATTAACAGGGCAGATATGGTTGATTACGGGAATGCCTTCAATTTAACAAGATATCTGGCTGACGAAACCGAATATATTGTGTGGGAT[C/T]GAGTTTCTGCTTCTATCTCCTACGTGAGAGAAATGTTGGCTGATGATACAGTGCTGTACCCCTTATTTCAGGTTGGGCTCCAAAGTCTTTACTATAACTTCCAGAGCAGGAGACCTGTCTTTTTATGAAAAATCATGCAAAATGTGGACTTGTTCCCAGTGTGAGATTTGTAGCTGATTTTTTTGGATAAACATTTTCTAGATGTGAATTGTTCATGTGTTTTGTTTTTCACGTTTTCTGTTTCACATCATATCTGTTTAGAAATTATTCAGGGGTCACGTGCAGAAGATATCCAGAGAGCTTGGCTGGAAGGATGAGGGGAATCAAACACAGCGGTGAGAATACTTTGGGAGAAAAAAAATCTTGTGTATATTTGCTAAATGGTTTGATTTTGTTAATGTTATCACATATACAGTGGCGTCCATATGTCTGAGAGTTCAAGTGAAAATTTCTGTCACTTTTGGATTTTGGATTCAGTTTTTTATTTCCAACTTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10319
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 816 951 17 20
Genomic Location (Zv9):
Chromosome 13 (position 12416583)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12414951
GRCz11 13 12547426
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAAGTATCTGTCTGCCACYCTGGCCCAGGAGAAAGATAAGCTGCTCTA[T/G]GRYCTGGCTTCAGTCAAAAATATTCATCTGCTTCATAGGTAAACRTACAC
Long Flanking Sequence:
TCTAACATGAATTAGCATTTAGTTAGCATAGGTAACAATTTAACATGTTGCATCTTGAATAAACTAACATGTTGCTATTAGAATAAGCACATTGCGAGTATGTTTTTAACATGAATTAGCATTAATGTCTACGCTTGTAATAATGAGCTCAACAAACTAAACTTCTTCTTTTTCCTCCTCAGGCTGCTGAGAGAGATCGTTTTGGGCATTGCATGTCAAATGGGTGACCAGGAAGCTCTTGACCAAGCCTCTGATATTTTCAATAAATGGATTAAAGGAACAATCGGGTAAACGTGTGTACATAAAGCCTCATAAGATGTCTAGAGAGTGTATTAAATAAGCTTTTTTCTCTGATTGGGGAGCAGCAGTGTGCCTGTGAACTTGCGTCTGCTGGTATATCGGTACGGCATGATGAACTCAGGAACAGAGGAGAGCTGGGAAATCATGTTCCAGAAGTATCTGTCTGCCACTCTGGCCCAGGAGAAAGATAAGCTGCTCTA[T/G]GGTCTGGCTTCAGTCAAAAATATTCATCTGCTTCATAGGTAAACGTACACTTGAGCAGTGTTAAAGGCTAAGGTCTATACAGGATACAGCTGCGGAAACGCACATCAATATAGCATGATTTTTGTGACACTGTATAACAATAAGTAATGTTTTTACAGTACTGTGACGGTTGGGGGTAGGTGTTAATCAAATGCAATAATTGGGAAATGTAATAAATAACAAATAATATTCTGTACAACTACGGTTTAAACCAGCGGTCACCAATCTCGGTCCTGGAGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGTCTCAACACACGTGGCTGGATGTTTCAAGTATACCTCTGAGCTGCTTGATTAGCTTGTTCAGGTGTGTTTGATTAGAGTTGGAGCTAAAATCTGCAGGACAGCGGCCCTCCAGGAACAAGTTTGGTGACCACTGGTTTAAACAGTACTGTGATGGTTGAGTTTAGAGTTGGGGTAGGGGTAGATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2718
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Essential Splice Site 829 951 18 20
ENSDART00000079655 Essential Splice Site 829 951 18 20
Genomic Location (Zv9):
Chromosome 13 (position 12415885)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12414253
GRCz11 13 12546728
KASP Assay ID:
554-3396.1 (used for ordering genotyping assays)
KASP Sequence:
TTAATGAATTRATATAAATTGAAASTATTTCAACATGTTTGTTTTCTAAC[A/T]GGTTGCTTGAAGCCACAAAAAATGAAAGCATCATAAGGAGTCAAGATGTT
Long Flanking Sequence:
AATTGGGAAATGTAATAAATAACAAATAATATTCTGTACAACTACGGTTTAAACCAGCGGTCACCAATCTCGGTCCTGGAGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGTCTCAACACACGTGGCTGGATGTTTCAAGTATACCTCTGAGCTGCTTGATTAGCTTGTTCAGGTGTGTTTGATTAGAGTTGGAGCTAAAATCTGCAGGACAGCGGCCCTCCAGGAACAAGTTTGGTGACCACTGGTTTAAACAGTACTGTGATGGTTGAGTTTAGAGTTGGGGTAGGGGTAGATGTTAATAAAATACAATAAATGGGAATTTTAATAAATAATATAAATAATTCTTGTTAACTTCAGGCCGCAATCGTATCTGATTTAGCAACATCTGTGTTAAAGAAGTCTGTTTTGTTTGTTTTGTACTGTTCTCTGAGCTCCGCCTTAATTTTTAATGAATTGATATAAATTGAAACTATTTCAACATGTTTGTTTTCTAAC[A/T]GGTTGCTTGAAGCCACAAAAAATGAAAGCATCATAAGGAGTCAAGATGTTTTTACTTTAGTGCAATACGTGTCACGAAGCTCTGATGGTAAAATTATGGCCTGGGACTGGATGACGCTCAACTGGGATTACCTGGTGAACAGGTTAGTTCATCTAACCGCTGAAATAAAACTAAAAACAGCACTTGTGTTGAGTAAAAATGCCTTTAAAGCAAGTCATTTTAGTTGGCCGCCATTTTTGAAACACCTCATGGGCGTGCTTGGACATTTTGTTTGAATGGGGAAACATCAAATTCTCCTAAATTGTTTACCAAGCTTACGAAGAAATTTCATATTTGGAATCGCCAATAATGTTAAACATCAACTGTCTCTCACGTTTAGTTTCTAAATGTATTAAACAAAGTTGGCATTTTTTTTAGGTTGCCCAAACTAACGCGTTTGCGCAACCGAAGGGAATGAAATCACGACACCAACTTCGTTTATGTGCGTTTTACACATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5788
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Essential Splice Site 829 951 18 20
ENSDART00000079655 Essential Splice Site 829 951 18 20
Genomic Location (Zv9):
Chromosome 13 (position 12415885)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12414253
GRCz11 13 12546728
KASP Assay ID:
554-3396.1 (used for ordering genotyping assays)
KASP Sequence:
TTAATGAATTRATATAAATTGAAASTATTTCAACATGTTTGTTTTCTAAC[A/T]GGTTGCTTGAAGCCACAAAAAATGAAAGCATCATAAGGAGTCAAGATGTT
Long Flanking Sequence:
AATTGGGAAATGTAATAAATAACAAATAATATTCTGTACAACTACGGTTTAAACCAGCGGTCACCAATCTCGGTCCTGGAGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGTCTCAACACACGTGGCTGGATGTTTCAAGTATACCTCTGAGCTGCTTGATTAGCTTGTTCAGGTGTGTTTGATTAGAGTTGGAGCTAAAATCTGCAGGACAGCGGCCCTCCAGGAACAAGTTTGGTGACCACTGGTTTAAACAGTACTGTGATGGTTGAGTTTAGAGTTGGGGTAGGGGTAGATGTTAATAAAATACAATAAATGGGAATTTTAATAAATAATATAAATAATTCTTGTTAACTTCAGGCCGCAATCGTATCTGATTTAGCAACATCTGTGTTAAAGAAGTCTGTTTTGTTTGTTTTGTACTGTTCTCTGAGCTCCGCCTTAATTTTTAATGAATTGATATAAATTGAAACTATTTCAACATGTTTGTTTTCTAAC[A/T]GGTTGCTTGAAGCCACAAAAAATGAAAGCATCATAAGGAGTCAAGATGTTTTTACTTTAGTGCAATACGTGTCACGAAGCTCTGATGGTAAAATTATGGCCTGGGACTGGATGACGCTCAACTGGGATTACCTGGTGAACAGGTTAGTTCATCTAACCGCTGAAATAAAACTAAAAACAGCACTTGTGTTGAGTAAAAATGCCTTTAAAGCAAGTCATTTTAGTTGGCCGCCATTTTTGAAACACCTCATGGGCGTGCTTGGACATTTTGTTTGAATGGGGAAACATCAAATTCTCCTAAATTGTTTACCAAGCTTACGAAGAAATTTCATATTTGGAATCGCCAATAATGTTAAACATCAACTGTCTCTCACGTTTAGTTTCTAAATGTATTAAACAAAGTTGGCATTTTTTTTAGGTTGCCCAAACTAACGCGTTTGCGCAACCGAAGGGAATGAAATCACGACACCAACTTCGTTTATGTGCGTTTTACACATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35436
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Essential Splice Site 903 951 19 20
Genomic Location (Zv9):
Chromosome 13 (position 12413283)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12411651
GRCz11 13 12544126
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCAGAATTACAACTACATACAGCTCTAATCTTCAACTGTGGAAG[G/T]TGAGATTTTCTTTTTCTATTCTTTTTTACTTCACTTTAAATGTCCTTATT
Long Flanking Sequence:
GTTTTCCAGCTCTTTTTCATCCCCGCTTCTAGCAGCACACTCCATTTCCGCATTACTGGATCTGTAGCGACAACAGACCGCAAGGGATGATGGTCAAGCATGGGCTGATGGGAATTGTAGTTTTCGCTACCTCCCGTTCGCTTCATTCGCCTGAGCAAATTTTCTCAGAAGACCTATAGTTTTACCGAGTCATGCGACTACGGTAATATCGTAAAAAATTAATATTGCGGTATGACGGTATTTACAATACCGTTACATCCCTAGTCTTTAGTGATTGATGATTTGCTCCTTTACTTGAAGACGGGCTTCATTCACCAAATTGACCATTACAATTTCCCCCATTCAAAACTATACGGGTGACATGATTTGTGACGTTGATTAAGTATAATAAAGATCTCTGTTCTCTGCTGCTTGTTAGATACACTATCAATGACAGAAATTTGGGCCGCCTGCCAGCCAGAATTACAACTACATACAGCTCTAATCTTCAACTGTGGAAG[G/T]TGAGATTTTCTTTTTCTATTCTTTTTTACTTCACTTTAAATGTCCTTATTTTTGGACCATCCAACTATGCAATGAGTCAAAATATCTCATAAGTTGATTTCTTTGTTTTAGATGGAGCACTTTTTTGCCCTGCACCCGAATGCAGGAGCAGGTGAGATGCCCAGAAAGCAGGCACTGGAGACTGTGAAGAACAATATCGAATGGGTGGAAAGGAATAAGGATGAGATCCGGTTCTGGCTGGAGAACAATGTGTCCTAGTACTAGAAGAACATTTTTTGCCCACCCCTCAAGTAATTAGGATTCACAAGTCAATGAATTGCTCAGGGCAGCTTGAAAATGAATCTTTAGCAAAGAGCCATAATTGCGTTCATGACAGTTAAATGAAACAAAACGCTTTCTGGAACTACAGTAGGCATTACAAATCCTTTGGAACTGTACATTGTTTCTTTATTTAATGTGTTGCAATTGACATAAAATGTTTTATTTGTAAAATGCGTAAA
Associated Phenotype:
Not determined