Busch Lab

ZMP

wu:fc13c02

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6739 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4240
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079661 Nonsense 386 683 1 2
ENSDART00000134418 Nonsense 389 684 5 5
ENSDART00000141305 None None 128 None 3

The following transcripts of ENSDARG00000057062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27376469)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27209291
GRCz11 23 27135832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGACTACAGCCCCCCAGCAGCYATGACAGGAGAGAATGGAGGTGCGGAG[C/T]AGGGTTTCTCACAGAATCGTTCTCAGAAGCGCTCTGATCCCATGAAAAGC
Long Flanking Sequence:
CTACTGCCCCTGTGTACAACTACCCACCTAGCACCTACCCCCACCAGACTGGCCTTGCTCCTAGCTACACCCACCCAACAGCCCCCTACATCCCCTCTCCACTTCCCTCAAGACCCACAGTGGTTGGTGGCAGCTATGGCTATCAGAACAGCAGTGTAGGAGGCTCAGAGCCTGGGGGCTCCCTGAAGAGAAAAGCATTTGAGATGACTCTGGATGAGGAAGACAGTGACAGTTCACGCTATAGGAAATATAGCTATGACCCCATGAAAACTGGGGGAGATTCTCCATATGGGGTCACTGATAAAGCTGGAAATGGCTTTGGAACAGGTAGCACTGATCCTCAAGGCTTTAAACCTAGTAAACCTTCATCTCAGTCAAGCCTGGAAGGAGATGAGGTGGGAAAGTACAGTGGGCTAAAGCCCCTGGTTTCACCAACATACGGAGCCGCAGGGGACTACAGCCCCCCAGCAGCTATGACAGGAGAGAATGGAGGTGCGGAG[C/T]AGGGTTTCTCACAGAATCGTTCTCAGAAGCGCTCTGATCCCATGAAAAGCATAGAGCCCAGAATGCTGGAGCTAGTTAGCCGGGAACTGCAGGACTGCAGTCCAGCTATGCTTTGGACTGAACTGGCTGGGAACTGTCACATTAAAGCAGCATTAGAAGAGGACCTGCTGTGGCCTGTCCTGCGACCCAACCCTGCAATCCACCCACCAAAAACCATCCTGCTATTTGGCCCTCAAGGAGGGGGCAAAACCACACTAGCACGATCCTTGTCATCTCAAATAGGTGCCTCCTTCTATAGGCTGAGTTGTGCAACATTGGCCTCTAAATTGAAGGGAGAAGCAGAGCAGCTCTTGCTCACCCTGTTCTCAGTTGCAACTGCCAGACAACCCGCAATGGTGTTGCTTAGTGAGGTGGAAGCCATTGAGGAGGAAGGTCTCAGACAGCAACTGCAAGCTCAGCTGGAGAAGATACAACATAATCAGAGCAACCAGTTTCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6739
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079661 Nonsense 437 683 1 2
ENSDART00000134418 Nonsense 440 684 5 5
ENSDART00000141305 None None 128 None 3

The following transcripts of ENSDARG00000057062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27376315)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27209137
GRCz11 23 27135678
KASP Assay ID:
554-5374.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTWTGCTTTGGACTGAAYTGGCTGGGAACTGTCACATTAAAGCAGCAT[T/G]AGARGAGGACCTGCTGTGGCCTGTCCTGCGACCCAACCCTGCAATCCACC
Long Flanking Sequence:
TGTAGGAGGCTCAGAGCCTGGGGGCTCCCTGAAGAGAAAAGCATTTGAGATGACTCTGGATGAGGAAGACAGTGACAGTTCACGCTATAGGAAATATAGCTATGACCCCATGAAAACTGGGGGAGATTCTCCATATGGGGTCACTGATAAAGCTGGAAATGGCTTTGGAACAGGTAGCACTGATCCTCAAGGCTTTAAACCTAGTAAACCTTCATCTCAGTCAAGCCTGGAAGGAGATGAGGTGGGAAAGTACAGTGGGCTAAAGCCCCTGGTTTCACCAACATACGGAGCCGCAGGGGACTACAGCCCCCCAGCAGCTATGACAGGAGAGAATGGAGGTGCGGAGCAGGGTTTCTCACAGAATCGTTCTCAGAAGCGCTCTGATCCCATGAAAAGCATAGAGCCCAGAATGCTGGAGCTAGTTAGCCGGGAACTGCAGGACTGCAGTCCAGCTATGCTTTGGACTGAACTGGCTGGGAACTGTCACATTAAAGCAGCAT[T/G]AGAAGAGGACCTGCTGTGGCCTGTCCTGCGACCCAACCCTGCAATCCACCCACCAAAAACCATCCTGCTATTTGGCCCTCAAGGAGGGGGCAAAACCACACTAGCACGATCCTTGTCATCTCAAATAGGTGCCTCCTTCTATAGGCTGAGTTGTGCAACATTGGCCTCTAAATTGAAGGGAGAAGCAGAGCAGCTCTTGCTCACCCTGTTCTCAGTTGCAACTGCCAGACAACCCGCAATGGTGTTGCTTAGTGAGGTGGAAGCCATTGAGGAGGAAGGTCTCAGACAGCAACTGCAAGCTCAGCTGGAGAAGATACAACATAATCAGAGCAACCAGTTTCTGGTGGTGTGCACCACAAGACGGCCTGATTTGATCAAAGATTCCCTTCTGCGCTGTTTTTCCAAGCGTTATCACATAGGCCTGCCAGATGGGAACACACGCAGACACGTGCTTCTGCAGGCGCTGGCGCCCCAGGGCTGCAGTCTCAGCGAAAGGGAGT
Associated Phenotype:
Not determined