Busch Lab

ZMP

NP_001177236.1

Ensembl ID:
ENSDARG00000057049
Description:
potassium channel, subfamily K, member 18 [Source:RefSeq peptide;Acc:NP_001177236]
Human Orthologue:
KCNK18
Human Description:
potassium channel, subfamily K, member 18 [Source:HGNC Symbol;Acc:19439]
Mouse Orthologue:
Kcnk18
Mouse Description:
potassium channel, subfamily K, member 18 Gene [Source:MGI Symbol;Acc:MGI:2685627]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10771 Nonsense Available for shipment Available now
sa6474 Nonsense Mutation detected in F1 DNA Not yet available
sa8409 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10771
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079646 Nonsense 120 391 3 3
ENSDART00000079646 Nonsense 120 391 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23608333)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23758482
GRCz11 17 23778506
KASP Assay ID:
554-4184.1 (used for ordering genotyping assays)
KASP Sequence:
AGAATTTGTWACTCTGTTCTGTTTTGTTTTTTTGTATATCAGGTTATGGA[C/T]GAATTTATCCGTTGACAAGTAAAGGGAAAGTGGCATGTGTCCTGTATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6474
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079646 Nonsense 120 391 3 3
ENSDART00000079646 Nonsense 120 391 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23608333)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23758482
GRCz11 17 23778506
KASP Assay ID:
554-4184.1 (used for ordering genotyping assays)
KASP Sequence:
AGAATTTGTWACTCTGTTCTGTTTTGTTTTTTTGTATATCAGGTTATGGA[C/T]GAATTTATCCGTTGACAAGTAAAGGGAAAGTGGCATGTGTCCTGTATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079646 Nonsense 162 391 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23608461)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23758610
GRCz11 17 23778634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCATCTCGGATGTGGGYGATCTCTTAGCTGTTCTCCTCTCCAAAGCATA[T/G]ACTCGCCTTAACCTGTTCTTCAGAMGAKGGATAGGACATCAGTCATGGAG
Associated Phenotype:
Not determined