Busch Lab

ZMP

si:ch211-191j22.8

Ensembl ID:
ENSDARG00000057039
ZFIN ID:
ZDB-GENE-091204-10

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15661 Essential Splice Site Available for shipment Available now
sa37290 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15661
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065596 Essential Splice Site 33 553 1 9
ENSDART00000132174 None None 150 None 5
Genomic Location (Zv9):
Chromosome 21 (position 20131521)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21267010
GRCz11 21 21303646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGAGGGTCTGCAGGACCAGAGGAAGGGGTCTTACAACAGCTTGCCAAGA[G/A]TGAGTTTGAAATCMATGTTTTTAATTTTATTTTGAATAATCTGTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37290
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065596 Nonsense 314 553 4 9
ENSDART00000132174 Nonsense 48 150 2 5
Genomic Location (Zv9):
Chromosome 21 (position 20141415)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21276904
GRCz11 21 21313540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGAGCTCAAAGAATGTGTTTGGTCAGCCCCGAGTTGTTGCGTCTCTG[C/T]GAGCAGCTTGTTCACCGCGGCCCGTTCGCAAAAGCACAGTGGTGGAGGAC
Associated Phenotype:
Not determined