Busch Lab

ZMP

NP_001038711.1

Ensembl ID:
ENSDARG00000057013
Description:
cell adhesion molecule 3 [Source:RefSeq peptide;Acc:NP_001038711]
Human Orthologue:
CADM3
Human Description:
cell adhesion molecule 3 [Source:HGNC Symbol;Acc:17601]
Mouse Orthologue:
Cadm3
Mouse Description:
cell adhesion molecule 3 Gene [Source:MGI Symbol;Acc:MGI:2137858]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38354 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44546 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33009 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38354
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596 None None 373 None 8
ENSDART00000111246 Essential Splice Site None 393 None 11
ENSDART00000124222 None None 413 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 44244756)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44330257
GRCz11 2 44183255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCTGAACCGACGGAGCCATCGGGCATCACGAGGAGCGCTTATATCGG[T/C]GAGTATCGTAATCTGCCCTCCTTTTGAGCTCACAGACACGCAGGGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44546
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596 Essential Splice Site 51 373 2 8
ENSDART00000111246 Essential Splice Site 64 393 4 11
ENSDART00000124222 Essential Splice Site 91 413 3 9
Genomic Location (Zv9):
Chromosome 2 (position 44155380)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44240881
GRCz11 2 44093879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGGCACCTATGTAGTGTATGTGTTCCTCTTATCGGTTCTGTCTTTTTC[A/T]GCACTGAGAGATAACCGTATCCAGTTGGTAAAGTCCACGGCCACGGAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25895
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596 None None 373 None 8
ENSDART00000111246 Essential Splice Site 312 393 9 11
ENSDART00000124222 None None 413 None 9
Genomic Location (Zv9):
Chromosome 2 (position 44127715)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44213216
GRCz11 2 44066214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATTCATCCCTTCATCCTCTTGAGAAGAAGCCGGAGAGAACGCCGCAG[G/T]TATTGTCACCTCAAACTTTCTCTCTTTTCTTTTTCTTTCGTTTCTTCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33009
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596 Essential Splice Site 335 373 7 8
ENSDART00000111246 Essential Splice Site 355 393 10 11
ENSDART00000124222 Essential Splice Site 375 413 8 9
Genomic Location (Zv9):
Chromosome 2 (position 44117885)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44203386
GRCz11 2 44056384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTCTGTCTCCTCCTTGTCCTCGGCAGATACCTCATCAGACACAAAGG[T/C]AACACACACACACACATACAAGGCAAATCAGACAAAGAAATCTCTTACTC
Associated Phenotype:
Not determined