Busch Lab

ZMP

Q1RLR4_DANRE

Ensembl ID:
ENSDARG00000057004
Description:
LOC563523 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLR4]
Human Orthologue:
FGL1
Human Description:
fibrinogen-like 1 [Source:HGNC Symbol;Acc:3695]
Mouse Orthologue:
Fgl1
Mouse Description:
fibrinogen-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:102795]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27608 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9778 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7856
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079566 Essential Splice Site 159 345 4 8
Genomic Location (Zv9):
Chromosome 10 (position 25119794)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24719146
GRCz11 10 24688598
KASP Assay ID:
554-2410.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGGACTGTGATTCAAAAAAGAATYAATGGGAAAGTTGATTTTGACAGG[T/C]AAGTACATTGTCTTGTCCTTAGACCGACAAAAATATCAGCATTATTAAAT
Long Flanking Sequence:
TTTATTAGTTCACGATAAAGGTAATGCGCCACATAAAAAAACCTATGCACATGTATATTTCTAATTAAACCATTCATTACTTTATGAAAAATGGGTATAAACTCTTTTTTTTTACATTTTAAAGAGCTTTGTTTTTAAATGTACATTATTTTCTGTCCTTCATAATGTTTGTAATTATTGTGGCTTTATTGAGGTTCTTGCATTTCAACAAAAATGGGATACAAATTAAACAAAAATTACATAACTGCTTTTTTTGTGATAATATGAAGGGTTGAAGATCAATAATAATAATTTTAAAAAAAAAGTCACATGGTTATTTATGGAATGTATGTCCATTAGACTGTTCAGAGTTATATGACAGACTCAAACCAGTCAGTGGATTCTACAGGATCAAACCCAAACCATTACTCGAACCATTCCTTGTATACTGTGACATGGATGATGGGGGGGCCTGGACTGTGATTCAAAAAAGAATCAATGGGAAAGTTGATTTTGACAGG[T/C]AAGTACATTGTCTTGTCCTTAGACCGACAAAAATATCAGCATTATTAAATCTGCATTTCTTTTCACAGAAAGTGGGAAGATTATAAAAATGGATTTGGAAATTTTCAGTCAAGTAAAGATGAATTCTGGCTTGGGAACGATCATATTCATGTCCTTCTCAGTGATGGTAAGTTTTGTATATTTATTCGCAAGTTTATTACACTTCTTTTCTGTTCAACAATATTTTATTAACACCCTTTAGGTGACAGTGTGATGAAAATTGATCTGACAGACTGGAAAGGAGGGAAATCATATGCCATGTATGACAACTTCAAAGTGTCAGATGAAAAAGTAATGTTCTTTTAGGTTCTTACCATTATTTATGCATAAAAGAAGTTCATATGGATGAAGTCTCAATTACATTCCTCTCTGCTCACTATAGGATAAATACAGGCTGTACTATGGGATGTACAGTGGTCAAGCAGGAGATGCCTTGTCCGGAGGAGCCAATATGGTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27608
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079566 Essential Splice Site 222 345 7 8
Genomic Location (Zv9):
Chromosome 10 (position 25119374)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24718726
GRCz11 10 24688178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTTCATATGGATGAAGTCTCAATTACATTCCTCTCTGCTCACTAT[A/G]GGATAAATACAGGCTGTACTATGGGATGTACAGTGGTCAAGCAGGAGATG
Long Flanking Sequence:
TTGTATACTGTGACATGGATGATGGGGGGGCCTGGACTGTGATTCAAAAAAGAATCAATGGGAAAGTTGATTTTGACAGGTAAGTACATTGTCTTGTCCTTAGACCGACAAAAATATCAGCATTATTAAATCTGCATTTCTTTTCACAGAAAGTGGGAAGATTATAAAAATGGATTTGGAAATTTTCAGTCAAGTAAAGATGAATTCTGGCTTGGGAACGATCATATTCATGTCCTTCTCAGTGATGGTAAGTTTTGTATATTTATTCGCAAGTTTATTACACTTCTTTTCTGTTCAACAATATTTTATTAACACCCTTTAGGTGACAGTGTGATGAAAATTGATCTGACAGACTGGAAAGGAGGGAAATCATATGCCATGTATGACAACTTCAAAGTGTCAGATGAAAAAGTAATGTTCTTTTAGGTTCTTACCATTATTTATGCATAAAAGAAGTTCATATGGATGAAGTCTCAATTACATTCCTCTCTGCTCACTAT[A/G]GGATAAATACAGGCTGTACTATGGGATGTACAGTGGTCAAGCAGGAGATGCCTTGTCCGGAGGAGCCAATATGGTGGAGCAGTGGTCAGCCTCCCATAATGGCATGCAATTCAGCACCAGGGACCAAGATCATGATCGGTACCTGCAGGGAAGCTGTGCTGCAGAGAACAAGGGGGGCTGGTGGTATAACAGGTGATGCCAAGGGATTTCTGAGTTTTAGGTCTTAAAAGAATACTCCATGTTTTTTGACAATAGACAAATTGGACAATTTTCATAGAGTTAAACAGTTTAGTTTTACCCTTTTGTATCCACTCAGCCAATTTCTGGCTCTGATGGAAGCACTTTTAGCTTAGCATAGATCATTGAACTGGAATAGAGCATTAGCAGCTCGCTCATAAATGACCAAAGAGTTTAAGTCCTTTTCCTATTTAAAGTTAGACTCTTCTGTAGTAAAATCATGTACTAAAATGTTGCTATTTTCAAGGCCTTTATGGCTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9778
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079566 Nonsense 314 345 8 8
Genomic Location (Zv9):
Chromosome 10 (position 25118468)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24717820
GRCz11 10 24687272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTGGAGAGTACAAGGCCAAATATGACAATGGTATTGTTTGGAGCACCT[G/A]GAAAGGACTGTGGTACTCYCTCAGACACACWGTCATGAAGGTCCGGCCCA
Long Flanking Sequence:
AAGAGTTTAAGTCCTTTTCCTATTTAAAGTTAGACTCTTCTGTAGTAAAATCATGTACTAAAATGTTGCTATTTTCAAGGCCTTTATGGCTAGGAACTTCTGACGTAATATTCAAGGAATTTTGCTGCCATACCACATAGGGCATCTATTCCAATTCAATATATATTTCGATAATTGAGTTTTGCAATTATATGAATGCTATTATTTGATTAATTAGAACAGTTTGTCCTTCCAAAATTAGATTAGTAAATTATGCTAAGCTAAAAGTGCTCCCACTCGACCCAATGATGAGCTGAATGGATTCAGAAATGGTAATTGTTGGTTTTATGATTAAATGGTTTATCTCTAGGGTACTTCTTCCCCAATTTTCCAAAAATATTTGTTATTTTATGATACCTATTTTTTTATTTACAGGTGTCATGCTGCCAATCTTAATGGGAGATTTTACAGAGGTGGAGAGTACAAGGCCAAATATGACAATGGTATTGTTTGGAGCACCT[G/A]GAAAGGACTGTGGTACTCCCTCAGACACACAGTCATGAAGGTCCGGCCCAGCTCCCACATGGACAGCGTGGGTAGTGGAGGAGGGCCCACTGAATAGCGAGGTTGCTAAGCATCTTGTTATACACATTTGTGAATTATACTGTGTTAACTATAAGATTTACTGTGGTTTATTAACTTTTCAACCACATGACTGTCGAGCATAGAAAGAATCTTGGAGGGATGAAGGAAGAAAGTAATCTTGGTAGATTTGATGAATCCACCTGTTATTTTTAAAATAATCATAAATAATATAACTTTGCATGCAGCCATATAATAGCACTTGTAGCATACAATATGCATATTACATTAAAACAGCATTTTTACATGTGAAAAGTCTTGACTGATATTGTGTATCACTGTTTCGTAGTATAAAATAATCATTCAGGAAAAAAAAACTTTGTATATATATGTATATTTTGGTTTGTTATGGAAAAAAACCTGAGAATTCACATTTTCCAGTG
Associated Phenotype:
Not determined