Busch Lab

ZMP

CCDC30 (1 of 2)

Ensembl ID:
ENSDARG00000056961
Description:
coiled-coil domain containing 30 [Source:HGNC Symbol;Acc:26103]
Human Orthologue:
CCDC30
Human Description:
coiled-coil domain containing 30 [Source:HGNC Symbol;Acc:26103]
Mouse Orthologue:
Ccdc30
Mouse Description:
coiled-coil domain containing 30 Gene [Source:MGI Symbol;Acc:MGI:1920582]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa39404 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29909 Nonsense Mutation detected in F1 DNA Not yet available
sa43959 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37681 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11688 Nonsense Available for shipment Available now
sa24305 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39404
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Essential Splice Site 265 1207 7 27
Genomic Location (Zv9):
Chromosome 23 (position 21003872)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20788979
GRCz11 23 20715322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGTAGAGCAATTAAAACAGGAAGTGGATAAGCTGAAACAGTGTGG[T/A]AAGATTGTGTCTGATACTGTTCCATGATATCACATGTCTCTTAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Nonsense 439 1207 12 27
Genomic Location (Zv9):
Chromosome 23 (position 21005514)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20790621
GRCz11 23 20716964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAGAGGGACAATAAGAAAGTTGAAAAAAAGGATGAAGATCTGTTT[C/T]GAGGGACTGACTCTGAGGTAAAAATTAAGATAATGTGGAAAAAAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43959
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Essential Splice Site 532 1207 14 27
Genomic Location (Zv9):
Chromosome 23 (position 21007998)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20793105
GRCz11 23 20719448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAACCTCACGCAGGTTAAAGGAGAAAAGGGAATTTTGGAAGAAAAAG[T/C]AAGATCATTTAAGTATTTACTGCTTATTGCATTTTTATCACAGCTAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Essential Splice Site 533 1207 15 27
Genomic Location (Zv9):
Chromosome 23 (position 21008110)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20793217
GRCz11 23 20719560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGGATACTTCCTGTCGCTTGCAAATGCCAATGAGGTTGTGTTTGCA[G/A]GTGGCCCAGTTGGAGCGTGCTCAGTCTCGAATCCAGGATGACCTGACCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4229
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Nonsense 739 1207 18 27
Genomic Location (Zv9):
Chromosome 23 (position 21009439)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20794546
GRCz11 23 20720889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTAAAACAGGAYCTGCAGAGAACCCAGCACCTCTTCACCTCGGCTGAG[C/T]GAGAGCTACGCTACGAGAGAGAGAAAAATCTTGACCTTAAGAGACACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11688
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Nonsense 771 1207 19 27
Genomic Location (Zv9):
Chromosome 23 (position 21010171)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20795278
GRCz11 23 20721621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAACATCATGTTTATGCTTSGTTTTCTTTAGCTGTGTGCAGAGCTGAAG[C/T]AGGCCCAGGCCAAAGTAGCCCAGCATGAGGGGARCGCAGCAGGACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24305
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Essential Splice Site 983 1207 22 27
Genomic Location (Zv9):
Chromosome 23 (position 21013697)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20798804
GRCz11 23 20725147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGAAGAGCTGAAGCTGGTCGTCCAGCAGCTTGACACAAATGTCAGG[T/C]ATTATTCCTCAATGGCTGAAAATGACAGTAGAGTTTGGCGTAGGTTGCAT
Associated Phenotype:
Not determined