Busch Lab

ZMP

si:dkeyp-38g8.5

Ensembl ID:
ENSDARG00000056954
ZFIN ID:
ZDB-GENE-081104-62
Description:
hypothetical protein LOC568385 [Source:RefSeq peptide;Acc:NP_001116762]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14997 Nonsense Available for shipment Available now
sa20246 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050407 Nonsense 222 342 4 4
Genomic Location (Zv9):
Chromosome 4 (position 15387487)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16330327
GRCz11 4 16319303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTAGAAAGCGATAAAGCAGCTATTGAATATGAAAGGATGGTGCTARAG[C/T]GAGAGAAGATGGTGCTAGACAGAGAAYGAGCGGGAGTGGAAAGAGAACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5255
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050407 Nonsense 231 342 4 4
Genomic Location (Zv9):
Chromosome 4 (position 15387514)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16330354
GRCz11 4 16319330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATATGAAAGGATGGTGCTAGAGCGAGAGAAGATGGTGCTAGACAGAGAA[C/T]GAGCGGGAGTGGAAAGAGAACTGGCAGCACTGGATCGAGACAGAGCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20246
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050407 Nonsense 292 342 4 4
Genomic Location (Zv9):
Chromosome 4 (position 15387697)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16330537
GRCz11 4 16319513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTGACAGAGAAAGGGCTAAGCTTGAAAGAGAACGGGCCATCCTGGAT[C/T]AACAGCGTGGGATTGAAAAAAGCGAGCAGACGGTTAATTTAAACGACAAT
Associated Phenotype:
Not determined