Busch Lab

ZMP

epyc

Ensembl ID:
ENSDARG00000056950
ZFIN ID:
ZDB-GENE-041008-9
Description:
epiphycan [Source:RefSeq peptide;Acc:NP_001017903]
Human Orthologue:
EPYC
Human Description:
epiphycan [Source:HGNC Symbol;Acc:3053]
Mouse Orthologue:
Epyc
Mouse Description:
epiphycan Gene [Source:MGI Symbol;Acc:MGI:107942]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45173 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26267
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079523 None None 321 None 7
ENSDART00000101461 Essential Splice Site 468 712 5 10
ENSDART00000128932 Essential Splice Site 468 712 4 9

The following transcripts of ENSDARG00000056950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 15392114)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16334954
GRCz11 4 16323930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCCCCAGATTTCACCACTACAGTGTTAATTCCTGACTTAGATGAAGG[T/G]TAGTATCATGATTTCAATACATCACTTTACAGCTTCTAGGTCTAGGTATG
Long Flanking Sequence:
GAGATGCCAGCAGAATCTGGGTCCTCTGAGGAGCCTGAGGTATCTGGAGAATCAGGGACCTCTGGGGTACCTGAGGTATCCGGAGAATCTGGGACCTCTGGGGTACCTGAGGAATCTGGGATCTCTGGGGTACCTGAGGTATCTGGAGAATCTGGAACCTCTGCGGTACCTGAGGTATATGGAGAATCTGGAACCTCTGGGGTACCTGAAGTATCTGGAGAATCTGAGACCACTGGGGTACCTGAGATATCTGGGGAATCTGGGATTTCAGAGGTGCCTGATGTGTCTGGACAGCCAGAGACCTCAGAGGCACATGAAATGACTGTAAAGCCTGAGATCTTTGAGGTGCCTGAGGAATCTAGAAAGCCTGGACCCTTTGACATATTTGAAGAGTCTGGGGTACATGAGGAGTCAGGAGAGTCTGGGAGCCCAGAAGAGACTGAGGTGACTGAGGCCCCAGATTTCACCACTACAGTGTTAATTCCTGACTTAGATGAAGG[T/G]TAGTATCATGATTTCAATACATCACTTTACAGCTTCTAGGTCTAGGTATGTTAAGGGGTGATTTCTATAGATCAGGAATGGATTTGGAGACCAGATTAAAATACGATTACATTCACTATTGAAGCTATTGTTGCACCAGTCAGCTCAAATAATCTGATATTATTGTTCTTAGAAACCTATATACTTCATTTAATGGGCCGATTTTAGATAAATGTGTTCACTTGCTTTATAACAACAATAATGCATTATAACATACCATTATCAAAATTAACCACTGTCTGTCGTGTTCCATTGTTAATATGTCCATGTGCTAACCTGTCTCCTAACACCTTAATATTGTTGTGTTTAACAAGAGGAGGAGATACTCCTAACCACCCCAACCACTCCCCTGGAGGGGACTGGGGGTGATATAGGGTCAGGCATACCTGATATTGACACAGATATTTACCCAGATATAACAGGTCAGTATTTTGCTTGTATTTAATCATTATTAGCGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45173
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079523 Nonsense 125 321 4 7
ENSDART00000101461 Nonsense 516 712 7 10
ENSDART00000128932 Nonsense 516 712 6 9

The following transcripts of ENSDARG00000056950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 15391139)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16333979
GRCz11 4 16322955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGGTGGTAAGGTATGTCTGTCTGTGTGCTGTGTACCTGTCTGGTT[G/T]GATCTGTGTACTGTGATGACCTCAAGTTGGACCGTGTTCCTCCCCTCTCC
Long Flanking Sequence:
TTGTATTTAATCATTATTAGCGTAACTGAAATTGATTGTTTTCATAACTGCATAATGTATGTATTTTTTTTTAGCTTTCCCATACTGATATATTCAGTGTGTTACCTGATAGAAAATATGTTGTTTAAAAGTTATACTTAATGTAATACGTAAAATTTCTGGGGTTTCAGTCCTGCTAGTGGAAGGCCACCAACCTAGAGTTTAGCTTTAACACATTTGTCTGGAAGTTTCTGACCATGAGGATCTTGATTGGTTCATGTGTTTAGTTAGATATAGAACTAAAGGTGGCCTATCAGGAGCTGGACATACTTTAAGAAGCACATGTTCATGTGCTCCAAAAGTGCAAAAAATGTTTGCTTTGTATATCCTAATAGGCAACGTCTGCATATGCATAAGTCCAGTTTTGGTGTTTTAATATGTATTTTTGTTTGTTTTCTTAATGCCACTGGCTGGTTTGGTGGTAAGGTATGTCTGTCTGTGTGCTGTGTACCTGTCTGGTT[G/T]GATCTGTGTACTGTGATGACCTCAAGTTGGACCGTGTTCCTCCCCTCTCCAAAGATACCACTCACTTTTATTCCCGCTACAATAAAATTTCCAGAATCAGCAAGTCTGACTTCGCCAACCTGAGTATGTGTATTAAAGGGGAAACCAAAAAGCACTTTCTTATCACATTTCAGTCTAAGTCAATCATCACTAACAAAACACAAACAAACACACATACAATACATCAGATTTTCAAGTAAGATTGCATGTCATGTTGATTGAACGCATACAGTTCATTTAGATTGCAGTCCTTAGAAAAAACAGCCTGATCTGATATATAGCAAAGGGGGGACCAAGTTCATTCATGGAGAGCCACTGTCCTGCAAAGTTTCGACCTCACCTGTCAGCCGCTTTCTAGTAGCCATAAGACCTTGACAGGCTTGTTCAGGTTTGTACGATTATTGCTGGAATGCAGGACTTTGGCTCCACAGAGCTGAAACTGGCCACCCCTGCTTTAGTAA
Associated Phenotype:
Not determined