Busch Lab

ZMP

sap130a

Ensembl ID:
ENSDARG00000056924
ZFIN ID:
ZDB-GENE-070615-5
Description:
histone deacetylase complex subunit SAP130 [Source:RefSeq peptide;Acc:NP_001092247]
Human Orthologue:
SAP130
Human Description:
Sin3A-associated protein, 130kDa [Source:HGNC Symbol;Acc:29813]
Mouse Orthologue:
Sap130
Mouse Description:
Sin3A associated protein Gene [Source:MGI Symbol;Acc:MGI:1919782]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33876 Nonsense Mutation detected in F1 DNA Not yet available
sa33877 Nonsense Available for shipment Available now
sa9968 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33876
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457 None None 639 None 11
ENSDART00000088903 Nonsense 200 333 5 8
ENSDART00000123324 Nonsense 199 1072 5 21
Genomic Location (Zv9):
Chromosome 6 (position 27733331)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28034542
GRCz11 6 28025103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGCTTCTTGTAGAAACGGTTTTGACAGGAATAATGTTTCTCCAGGGA[C/T]AGAGTAACCTGCATCAGCTAATGGCAACTAATGTGCAGATCTTCAGGGGC
Long Flanking Sequence:
GATTTGATTACAACTACATGGCAGGTATGTGAGACCATTGGTTAAGTGGAGAGGCTTCAATAGAATGGTTGTATGATTAACATTTAACCTTCTGAAAAAAATTATTTATTTATGTGTTTTTGTTTTACTTGCAACTACATTGTAAAATCTTTATAGACACATTTGGTCATTGAATGCATAATAATGCAAACATGAGGAGGTTTTGCTTCCTGATCTTGAATAAAGTAGATTCATTATGAAAGAAATGTGGAGAATTTGACAAAATGTTTAATTGACTGATTGAGTGATGAAGTCTCAAAGCTTGCCCACTTTTCTGTTACGCACTCAAAAGTGTGTACTTTTTATGAATAGGCAAACTGGAATGTAGCTATACAAAATATTTACCTATACAAAAATAGTGCCTTTAGGGCTTGTATAATAGGTTTGAAAACCCTTGCTTTATATTACACATAGTGCTTCTTGTAGAAACGGTTTTGACAGGAATAATGTTTCTCCAGGGA[C/T]AGAGTAACCTGCATCAGCTAATGGCAACTAATGTGCAGATCTTCAGGGGCAGTGCACCACTACAGATTGGATCTCCTGCTACTCCACACACCTTTACCTCCCATCTGCCCAGAGGTCAGTGATTTTATTCATACATGGATGACATTGCAGGTGTAGTTTCCCCAAATACATGGACATTCAATCATTATTTACTCATCCTCATGGGACTTCAGACCTGTGTGTAGGATTTGAGCAAGTTTTAAAGGGATGGTCAAAAAATGATAAGAAAAAAAAAGTTATGTGTGTATTGATATAGCGCATCGTGGTGTTTGGCAATACACCCAAAGCACTTCACAATCATGAGGGAGGGGGGTGGGGGGTCTCTCCACCATGCCACCAGTGTGCTGCATCCACTTGGATGATTCGACGGCAACCCTAGGCCACAGCGCCAGTGCGCTCACCTCACACCAGCTATAGATAGTGTATAGAGACAGTGATAGAGACAATTCGATGGATGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33877
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457 None None 639 None 11
ENSDART00000088903 None None 333 None 8
ENSDART00000123324 Nonsense 301 1072 7 21
Genomic Location (Zv9):
Chromosome 6 (position 27739649)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28040860
GRCz11 6 28031421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACATCAACTGCTGTTCTACCCACAATGGTGGCGCCAATCCCAGCTGCT[C/T]GAACCCAGTCCCCGGTCATCAACACCACTGTCACACACGCTACAGAGATG
Long Flanking Sequence:
ATGGCACTTCTTAAATCATTCAGCATAAATCCGCAGATTTTTTTTAACAAAATTATCCGCAGAATTAGCAGAAAATGCCTGCAGATTCTGTCTGGCCCTAGTAATAAGTTACTAGTTAAAGTTATTAGTTAGTAATAAAGTTAAGGTAACTAATAATTTAATAAAAAGCTAATAAAAATAAATAAGTAAACTAATAAAAAGCTTAATAATTTTGTAAATAAATGCTAAACAAATAAACTTTGGGTAAATATGTGTACAGTGGCAACACGGCACATCCTGGCCCTGACTATTCCTACTTTAATATAGTCGTAGTAGTTTATGCACTTTATTTGATGTTGCTGCTCATTTCTAAAATTTCCAGTAAAATCTCATTGGCATATTTGCAACATCTTTCTTTACTTCCTGATCTTTACCCAGTGTGTTTGTATTTACAGTCTCGTTCTTTGGTGACCACATCAACTGCTGTTCTACCCACAATGGTGGCGCCAATCCCAGCTGCT[C/T]GAACCCAGTCCCCGGTCATCAACACCACTGTCACACACGCTACAGAGATGGTTCATGGGTAATTACTTGCATTTATCTTTTTCGCGAAGCGTTATGCCAAGTACTTTTTGTCATGATAGTAGTGTTTATATTATTCTAATGAGAAGCTTGAATTTGCATTTTAGGCGGCCAGTGGCCATTCATCCTCCTCCAGCCACTATCAACATCCAGCGTCCACCAACACCTCGGGACACTGCTACTCGCATCACCCTCCCCTCACACCCAGCTATAGGAGGCCAGAAGGCTCAGCCCCCTCATACTGTCACACAAGTAAGTTTTCTTATAAGCATTTTTGAGTTGTCTCATTAAACATAGAAATGGGGGCATTTAATGGTTCGAAAGCTTCTCTTATACATAGGGGTTGGGCGATATGGCCCCTTTTTTTTTTTTTTTTAAATCCCCAATTTTTTCACCAAATAATTAATCTATGATTAAATAGATTTTTTTTTCCTCCTCAGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26753
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457 Nonsense 183 639 4 11
ENSDART00000088903 None None 333 None 8
ENSDART00000123324 Nonsense 616 1072 14 21
Genomic Location (Zv9):
Chromosome 6 (position 27745273)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28046484
GRCz11 6 28037045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTATTTATATACATATTTTATCTTTTTTTGCTTTACAGGTGTTGTTT[T/A]GGCTGAAAGTCCTGCTTTTGTCACTAATCCAATTGGAAGCACTTTTAGTG
Long Flanking Sequence:
TGATGGCACTGCCATCTGCCCAGATCAGCACCCAAAACATCCAACCAGCCTCTATGACTGCTCAGGGCATTCAGCCTGCACCAATAGGAGTGCAAGGGCTGCATGCCGCTGCACCAATCAGCACGCAGACTGTACAGCAGGCTCCTGTCACCACACAACAGCCTCAGTCAGAAGCAAAACCAGCAGGTAAGTTTAAGTTTACACTTCTATAGATGATTAGTAAATGAGAATGTATTATCATTGTGTCTTAAGAAAGCTAACATTCTGTTTTTAAATCATTATTACTTTAATTTTGACTGGTTAAAGAAAAAAAATTATAATTTTTTAACCACCCATAATATAATACAATATGTTGTTTTACTTTGAGGCCAATAAAAATGTTGCCAGGTCAAATAAATAGATTCAAATGTTATAAGTGACATTGTTTTGCACAGTGTTTTTAACTCATTTTATTTATTTATATACATATTTTATCTTTTTTTGCTTTACAGGTGTTGTTT[T/A]GGCTGAAAGTCCTGCTTTTGTCACTAATCCAATTGGAAGCACTTTTAGTGGCACTCAGCCGGTCACTACCATTGTGCAGACTCACACAGGTGCAGGTGCTCCCACACTTGTGTCCTCCCCTCGACCCAGCATCCTTCGCAAAAAACCTGTAACTGAAGGGTATGTCATCACATTATCCTAAAACATGGTTATTTATAGTATGGAAACTACTAAGGAGTCAAACTGTGCATCATTTGTGAGCAGTAGCATTACAATATTCCCTCATAAATGATGTCCTGAGAAGTAACAGAATCCAGTGTACTCTTTTTTTTTTTTTTTTTTTTTTTAATTATTATTATTATTTTAAATTTTGAGTCAGAAAAATTTTAATAAATAATGTAAAATCACTTTTGGGGTTTATTTCTAGGGCAGTGCGTAAATGTCTGATTCAAGCGCAGCCGAGTGAGCCTAACGCTGGCCGAGTGGATAGTGGGATAAGGCTGTCGGGATCCCCTCGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9968
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457 Nonsense 430 639 7 11
ENSDART00000088903 None None 333 None 8
ENSDART00000123324 Nonsense 863 1072 17 21
Genomic Location (Zv9):
Chromosome 6 (position 27749360)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28050571
GRCz11 6 28041132
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACCTGGAGAGCTTCWGCCTGGTGCCTCTCCAAGGAAGAAACCYCGGAAA[C/T]AGCAGCATGTGATCTCCACTGAGGAGACKGAGATGGTGGAGACTAACAGC
Long Flanking Sequence:
TTTTCCTATTGACGGAAATGGAGATCTTTCCTGTTTGCTTCAGAGTGTGCAGTAAGCTTTTAAAGCAGGGGTGTTTAAACATGTTCTTGAAATGTCTCTGACCTGCTGAGTTTAACATTTGCCCTAATTAAACACATCTGAAACGGCTAATCAGGGTCATTGAAACATCCAAGAATGTCTCTTCAGGATGTCGGCTCTCCAGGAACATGGTTGGACATTTTTGCAATACTGCATATTGTCAAAACAAAGTGAAGGATAACTCTTCTTTAAAATCTGTCATTTATCTGTTGTATGGTCAATTCTCCGTCCAGTTTCAGTAATGTCTGCTCAAATAAGCATTCTGATTTGGGCTTTAACGAGTTTGTTTGATCTCAGTACCTTTAGCTCCTTCCTTGACGGGTCCAGCTCCATCCCTCTCCTCACAGTCCTCGACTCTGACTGTATCTTCTCAACCTGGAGAGCTTCTGCCTGGTGCCTCTCCAAGGAAGAAACCCCGGAAA[C/T]AGCAGCATGTGATCTCCACTGAGGAGACGGAGATGGTGGAGACTAACAGCACAGATGAAGAGAGAGCTAGCAGTCGAGCTCCAGGAAACAGAATGGAAAGACATGAGTCACCACCTAGGGAATATGTTGGTAAGTCTACACACATACACACACATTTGTTTTTGTGAATTGAAGGATACCCCATAGGGTCACTAGTGCGTGCACAAGCCAGGAGATTGAAAACAAGGGAAGCACCATTTTTACATACACATCCGAGATGTATTCATTCCGAGATGATATTATTCAAATAATAATGAGCCATGGTCGATCTGAACTCAAACAAACCTTGTCGTCATCTTGATGAACAACCACAAAGCCAAGAAGAAGAGCTGAATCCGCCATTTGTCCTCTTGTTGTTTATGAGGGTGTCTAAAACCATGAGTGGTTTCACTTTCTTCAGAGAGCTTGTTGTGTGCTTGCCGCATTTCTATATTTAAAATAGCGAACTACTTGAGCTCATG
Associated Phenotype:
Not determined