Busch Lab

ZMP

LOC562072

Ensembl ID:
ENSDARG00000056922
Human Orthologue:
LTBP1
Human Description:
latent transforming growth factor beta binding protein 1 [Source:HGNC Symbol;Acc:6714]
Mouse Orthologue:
Ltbp1
Mouse Description:
latent transforming growth factor beta binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109151]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa36399 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23068 Nonsense Available for shipment Available now
sa7434 Missense Mutation detected in F1 DNA Not yet available
sa23069 Nonsense Available for shipment Available now
sa23070 Essential Splice Site Available for shipment Available now
sa9759 Essential Splice Site Available for shipment Available now
sa23071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Essential Splice Site 280 1384 7 35
Genomic Location (Zv9):
Chromosome 17 (position 22882457)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23032606
GRCz11 17 23052442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGAACCAAGAAATATGAAAATGAGTCCCTGATATTTATTTTCACCCTC[A/C]GACATTGATGAATGTCAGCTTCAAGGTGTTTGTCCAAATGGAAACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23068
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 342 1384 8 35
Genomic Location (Zv9):
Chromosome 17 (position 22887112)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23037261
GRCz11 17 23057097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTCGCGAGGAGAAGGGTGCTTGCTTCCGGTTTGTCGGTTCAGGGAAG[C/T]AGTGCTTGCACCCTGTGTCCACTCAGCTGAGTAAACAGTTATGCTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Missense 351 1384 8 35
Genomic Location (Zv9):
Chromosome 17 (position 22887140)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23037289
GRCz11 17 23057125
KASP Assay ID:
554-4034.1 (used for ordering genotyping assays)
KASP Sequence:
CCGGTTTGTCGGTTCAGGGAAGCAGTGCTTGCACCCTGTGTCCACTCAGC[T/G]GAGTAAACAGYTATGCTGTTGTAGTGTGGGCAAGGCCTGGGGTCCTCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8359
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 539 1384 14 35
ENSDART00000079460 Nonsense 539 1384 14 35
Genomic Location (Zv9):
Chromosome 17 (position 22895407)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23045556
GRCz11 17 23065392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCCTCTCTCATCAGAGATTGACGAGTGTGTAGTGAGACCTGATATCTG[T/A]GGTGCWGGAATCTGTTATAACACTGCWGAGAGCTACACATGCTTCTGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4710
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 539 1384 14 35
ENSDART00000079460 Nonsense 539 1384 14 35
Genomic Location (Zv9):
Chromosome 17 (position 22895407)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23045556
GRCz11 17 23065392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCCTCTCTCATCAGAGATTGACGAGTGTGTAGTGAGACCTGATATCTG[T/A]GGTGCWGGAATCTGTTATAACACTGCWGAGAGCTACACATGCTTCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23069
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 808 1384 22 35
Genomic Location (Zv9):
Chromosome 17 (position 22905403)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23055552
GRCz11 17 23075388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGCGTCAATATCTTAGGGTCTTACCAGTGCAATTGCCCACAGGGGTA[T/G]AGACAAGTCAATAGCACCAGCTGCCTTGGTGAGATAATCCTACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23070
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Essential Splice Site 946 1384 26 35
Genomic Location (Zv9):
Chromosome 17 (position 22918737)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23068886
GRCz11 17 23088722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTCATTGTAATGAAAGAAAAGTAATGAAACACTTTTACTTGTCTGCA[G/A]ATGTGAATGAGTGTGAGCTTCTCGGTAATGTGTGTGGTGAAGCCACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9759
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Essential Splice Site 1133 1384 30 35
Genomic Location (Zv9):
Chromosome 17 (position 22929284)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23079433
GRCz11 17 23099457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAYTGCAAATCTGGACTCTACTACGATGAGAGCAAAYTACAGTGTCTCGG[T/G]AAGAAACAAAAATCGCAGTCTAAACWAAAATGTTCATTAAGATTTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23071
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 1138 1384 31 35
Genomic Location (Zv9):
Chromosome 17 (position 22931794)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23081943
GRCz11 17 23101967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCTGTTTCTCTTTGTCTCTGATCTCTACAGACACTGATGAATGC[C/T]AAGATGAGGCAAAATGTAGAGATGGTGAATGCATGAACACATATGGCTCA
Associated Phenotype:
Not determined