Busch Lab

ZMP

ankk1

Ensembl ID:
ENSDARG00000056921
ZFIN ID:
ZDB-GENE-071015-4
Description:
ankyrin repeat and kinase domain containing 1 [Source:RefSeq peptide;Acc:NP_001124137]
Human Orthologue:
ANKK1
Human Description:
ankyrin repeat and kinase domain containing 1 [Source:HGNC Symbol;Acc:21027]
Mouse Orthologue:
Ankk1
Mouse Description:
ankyrin repeat and kinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3045301]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8927 Nonsense Mutation detected in F1 DNA Not yet available
sa5880 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22635 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8927
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079504 Nonsense 24 733 1 8
Genomic Location (Zv9):
Chromosome 15 (position 20975760)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22078386
GRCz11 15 22014118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTGAAGGACTCTTTTAAAGATGGCAGCCTGGAGGGGTTTAGTTATTTT[A/T]AAAAAGATGAGTTTGAAAGTGACTGGGAGAAACTGGTTGAGCGCAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5880
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079504 Essential Splice Site 308 733 7 8
Genomic Location (Zv9):
Chromosome 15 (position 20984976)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22087602
GRCz11 15 22023334
KASP Assay ID:
554-3893.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTAAAATCCATGACAATAAAATGAATTCAATTGTGCTTTCCCTCCATT[A/C]GCCCAAGAAAACGGCTGACTCCTCAGGCAAGTATTTTTCAATGCATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079504 Nonsense 605 733 8 8
Genomic Location (Zv9):
Chromosome 15 (position 20985982)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22088608
GRCz11 15 22024340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGAAAGGCCATCCGGAGATTATCCTCACCTTGGAGGAACACCAAGGCT[C/A]AGTCAACATTCAAGGGAAAAACGGCTGGACGCCTTTGCATCTTGCCTGTC
Associated Phenotype:
Not determined