Busch Lab

ZMP

Q08CT5_DANRE

Ensembl ID:
ENSDARG00000056836
Description:
LOC566639 protein [Source:UniProtKB/TrEMBL;Acc:Q08CT5]
Human Orthologue:
AHNAK
Human Description:
AHNAK nucleoprotein [Source:HGNC Symbol;Acc:347]
Mouse Orthologue:
Ahnak
Mouse Description:
AHNAK nucleoprotein (desmoyokin) Gene [Source:MGI Symbol;Acc:MGI:1316648]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa28844 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28844
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079401 Nonsense 461 566 5 5
ENSDART00000127837 Nonsense 462 1478 4 5
Genomic Location (Zv9):
Chromosome 17 (position 22378505)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22528654
GRCz11 17 22548490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGACATTCAAACTCCAGGAGCTCATGTGCAAGCACCAGATATTGACATT[G/T]AAGCTCCATCTGCAAAGGTAAAGAAGCCCCATGTTAAAATGCCCAAATGG
Associated Phenotype:
Not determined