Busch Lab

ZMP

cfhl2

Ensembl ID:
ENSDARG00000056778
ZFIN ID:
ZDB-GENE-041114-123
Description:
complement factor H like 2 [Source:RefSeq peptide;Acc:NP_001007419]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa24167 Nonsense Available for shipment Available now
sa37515 Nonsense Mutation detected in F1 DNA Not yet available
sa29780 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24168 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3208
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 150 606 5 12
Genomic Location (Zv9):
Chromosome 22 (position 24152627)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23720117
GRCz11 22 23746681
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACTTTGTACTCCTTTTACAGCTGTAACTTGYGAGCTTACTTCAAACTA[T/A]GAGGTGAAAAGGGTCGTCCCAGAGGGAAAAACTATTTTCAGAGCTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24167
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 180 606 5 12
Genomic Location (Zv9):
Chromosome 22 (position 24152715)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23720029
GRCz11 22 23746593
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGAGCTGGAGAAAGATTGACAATCACCTGCACTGAAAAAACCTGGTTT[A/T]GATCCAAAGAAACCATCAAAACATTTGCATGTCAAGATGATGGGACGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37515
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 291 606 7 12
Genomic Location (Zv9):
Chromosome 22 (position 24153400)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23719344
GRCz11 22 23745908
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGGTTTAGTCAACCCCTAAACAAAACAGTAATCTTTTACGCCTGCAAC[A/T]AGGGTTACAAACCATTCAATGGAGAATGGTGGAGTTCAGTGACGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29780
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Essential Splice Site 430 606 9 12
Genomic Location (Zv9):
Chromosome 22 (position 24154252)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23718492
GRCz11 22 23745056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGTTTTCTGCAGCAATGGAAAATGGGAAGAAACACCAACATGTGAAG[G/A]TGAGATTCTGGTTAATGGTTCATTCAGAACTTTGTTCTAGACAAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24168
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079324 Nonsense 519 606 11 12
Genomic Location (Zv9):
Chromosome 22 (position 24164423)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23708321
GRCz11 22 23734885
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGTAGGAATCCAGATGATAAAATGCCTACTGAGGTATACTATGAATGC[C/T]AGGCTTACTATGTGCTGAGTGAGAGAAAGCAATATTACAGGTGTGAAAAC
Associated Phenotype:
Not determined