Busch Lab

ZMP

cfhl1

Ensembl ID:
ENSDARG00000056771
ZFIN ID:
ZDB-GENE-050208-342
Description:
complement factor H like 1 [Source:RefSeq peptide;Acc:NP_001032792]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa29781 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29782 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29781
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062522 Essential Splice Site 606 725 12 14
Genomic Location (Zv9):
Chromosome 22 (position 24200917)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23671827
GRCz11 22 23698391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGGATCTGTGAAAATGGAAAATGGACTGGAGACTTTGTCTGCACAAG[T/C]AAGTCACTTAAAATGTTTTGGATATAAACTCTATGAATGTACTCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29782
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062522 Nonsense 641 725 13 14
Genomic Location (Zv9):
Chromosome 22 (position 24205282)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23667462
GRCz11 22 23694026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGATGATAAAATGCCTACTGAGGTATACTATGAATGCCAGGCTTACTA[T/A]GTGCTGAGTGAGAGAAAGCAATATTACAGGTGTGAAAACGGGAGATGGGA
Associated Phenotype:
Not determined