Busch Lab

ZMP

si:ch211-245p7.3

Ensembl ID:
ENSDARG00000056764
ZFIN ID:
ZDB-GENE-050419-219
Description:
Novel protein similar to vertebrate hydrocephalus inducing (HYDIN) [Source:UniProtKB/TrEMBL;Acc:Q1LW
Human Orthologues:
AC109135.1, AL360154.1, HYDIN
Human Description:
hydrocephalus inducing homolog (mouse) [Source:HGNC Symbol;Acc:19368]
Mouse Orthologue:
Hydin
Mouse Description:
hydrocephalus inducing Gene [Source:MGI Symbol;Acc:MGI:2389007]

Alleles

There are 28 alleles of this gene:

Allele Name Consequence Status Availability
sa32204 Nonsense Available for shipment Available now
sa43099 Nonsense Mutation detected in F1 DNA Not yet available
sa43100 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17962 Nonsense Available for shipment Available now
sa10786 Essential Splice Site Available for shipment Available now
sa36644 Nonsense Mutation detected in F1 DNA Not yet available
sa12926 Nonsense Available for shipment Available now
sa43101 Nonsense Mutation detected in F1 DNA Not yet available
sa12486 Essential Splice Site Available for shipment Available now
sa39199 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43102 Nonsense Mutation detected in F1 DNA Not yet available
sa36645 Essential Splice Site Available for shipment Available now
sa43103 Nonsense Mutation detected in F1 DNA Not yet available
sa29030 Nonsense Mutation detected in F1 DNA Not yet available
sa43104 Nonsense Mutation detected in F1 DNA Not yet available
sa8483 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17202 Nonsense Available for shipment Available now
sa25063 Nonsense Mutation detected in F1 DNA Not yet available
sa43105 Nonsense Mutation detected in F1 DNA Not yet available
sa16299 Splice Site, Nonsense Available for shipment Available now
sa12927 Nonsense Available for shipment Available now
sa14679 Nonsense Available for shipment Available now
sa43106 Nonsense Mutation detected in F1 DNA Not yet available
sa32205 Nonsense Available for shipment Available now
sa44889 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32204
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 72 4812 2 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 Nonsense 72 1146 2 21
Genomic Location (Zv9):
Chromosome 18 (position 21057182)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21287405
GRCz11 18 21276471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTAACCACAGAAGAGCGATTATCAAACACATTTGAGATGCGTCCGCCT[C/T]GAATCTTGGAGCTCTTAGACATGAGCGAAACCACACATCACAAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 168 4812 4 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 Nonsense 168 1146 4 21
Genomic Location (Zv9):
Chromosome 18 (position 21060711)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21290934
GRCz11 18 21280000
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAGTGGCTCCAGGCATGGCATCTACATTCACCATTCTCTTCACTCCA[C/T]AAGAGAACAAGGTAAATTTGTTAGTTCCAATAGAAATGCAATTGACGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 238 4812 5 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 Essential Splice Site 238 1146 5 21
Genomic Location (Zv9):
Chromosome 18 (position 21063149)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21293372
GRCz11 18 21282438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACGAAACATAGGAAATTGTGAGGCTAAATTCAAGCTTAGCACATGCAG[G/A]TAAGAGAGCAGCGTCAGTGCAAATTGCTTTGACATTGTAGTACGAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17962
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1015 4812 20 81
ENSDART00000100830 Nonsense 29 140 2 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21111712)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21341935
GRCz11 18 21331001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTGAGTGTTTWATAAATTGCAGGTGGTTACAGAGAAGCTTGTATGCTA[T/A]GCTGTTATCGGGAGGCAATATGTGAGGGAGTGCATCATCACTGCAGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10786
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 1054 4812 20 81
ENSDART00000100830 Essential Splice Site 68 140 2 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21111830)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21342053
GRCz11 18 21331119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCAGCAGTTGAGATCTCCTCCCAGCAACTYAACTTCTATGTAGAAAAG[G/A]TTTGCAAAAAAGAATTTTATGWTAATTTATTTACAAATTTATTTTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36644
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1072 4812 21 81
ENSDART00000100830 Nonsense 86 140 3 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 Nonsense 1011 1146 20 21
Genomic Location (Zv9):
Chromosome 18 (position 21117095)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21347318
GRCz11 18 21336384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCGATGCTTCTCTGGTTCCACTATATGAGAGGCTTATTCTGAAGAGTT[T/A]GTCCTCCTTGAACCTCTCTATGGAACTGCTAGTGCACGAGCCCTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12926
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1195 4812 22 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 Nonsense 1134 1146 21 21
Genomic Location (Zv9):
Chromosome 18 (position 21119089)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21349312
GRCz11 18 21338378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGCAAGCTCACTATGACCAACTGYAGCCCACKCTGCGTTTCATATCGTT[G/A]GGCCTTCCTGGTGGACCAACAACAGTGCCATAYTGGGTAGGAACAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43101
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1279 4812 24 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21125166)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21355389
GRCz11 18 21344455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATCATGGTAGCTCCAATGGAAATGAGCAAAATAGGACCTGCTTAACA[C/T]GAAGAAGCAAAGAGCTGGGAAGCAAACCCATCAATCTCACAGCCAACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 1303 4812 24 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21125242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21355465
GRCz11 18 21344531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCATCAATCTCAMAGYCAAYGGGCATCCGAGTGTGGRTGTGAAAGAGG[T/C]TGGTTTAAAGCCCAAATATACTACAGTTTTTTTNNACATATGTTTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39199
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 1886 4812 36 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21140721)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21370944
GRCz11 18 21360010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTGTGGCAGAATTCAAAGGTAATCTAAAAGTTCTCACCTCTTTTTTAA[G/T]AATCCACAGAAGGTCTTGCAGAAGGAGACAAGGGGGAAACAGATGCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43102
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 1929 4812 37 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 Nonsense 18 268 1 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21140957)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21371180
GRCz11 18 21360246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACCTAAGGGCAACAGCAGTGTTGTCACTGCAGTGGGGGATTTGGAATA[T/G]GACCCTGTATCTACAGCTGTCGCACGTTACATGGGCATCGATCTTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 2089 4812 38 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 Essential Splice Site 178 268 2 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21143108)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21373331
GRCz11 18 21362397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGGACGTTCACAGAAGAATGACAGCTCCAATCCTGCTGCCTCAGTGG[T/C]AAACACTTATTAATTTGGCACATACAATACACACAGTAGTAGAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43103
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2216 4812 41 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21147573)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21377796
GRCz11 18 21366862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAAGAGAAGAGCAAATGACTCCTAGTGAAGATTGGGATACCACCCCA[C/T]GACCTGAAGACCCTGTGCCCCTCTCTGAGGATGTAAAACAAGAGCTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29030
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2296 4812 42 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 Nonsense 65 161 1 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21147993)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21378216
GRCz11 18 21367282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGACATCACCGATTGTCCTCCATCTTCTGCAAAGAAGACCAAGAAGGAA[C/T]GAGAAAAGGAGAAAGCTGAGAGGGAAAAGTTAAAGGTTGATTCTGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43104
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2420 4812 43 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21148453)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21378676
GRCz11 18 21367742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCAACTACTTTACATTTTTGAAGCCCATATCTTGTGAGGACCTGT[C/A]AGAGAAAGAAAAAGAACTCGGATCAGAAACTGTCAAGGTACTAAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 2456 4812 44 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21150032)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21380255
GRCz11 18 21369321
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCCAACCCTGGCCAGTCTGAGGAGCCCAAMCCAGAATATAACCAAGGG[T/A]ATARGAGATTCCYTATGCAWATRAAAGCATKTAAAATCACWAATAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17202
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2524 4812 46 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 Nonsense 69 1388 2 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21150419)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21380642
GRCz11 18 21369708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAACTTAGTWGCCTTTTTTGTGTGTAATAGGATTCTGTTTGCCCACTGC[A/T]AAAAGAYACTGCRTCCKGAGAGTRGACTACAGAASACTTACRTTATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25063
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2794 4812 51 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 Nonsense 339 1388 7 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21154040)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21384263
GRCz11 18 21373329
KASP Assay ID:
554-7447.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACATTCAAAGTGTCAGAAGAAGTCAAGCGGTCTATTAAGTTAGAAAAC[A/T]AGGGCAAATATGACATAGCATTTAAGTAAGTTATGTAGATATTTAATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43105
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 2842 4812 52 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 Nonsense 387 1388 8 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21154271)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21384494
GRCz11 18 21373560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCTCTCTACGCCCCAACAATAAACCCACCACTGTCCAGATTATTTAT[C/T]AAAACGACAAAGAAATGTCCATCAGAGATAGCCCAATCCTTTGTTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16299
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 None 3230 4812 58 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 Splice Site, Nonsense 775 1388 14 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21158691)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21388914
GRCz11 18 21377980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGGCAAACTCTTCCATTAGTGATCAAGAACAACAGCAATGTGCCTGCA[C/T]AAGTAAGATAAGAATTTGTTTGACTAAACTACAGTTTATATGACTTTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29031
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 3237 4812 59 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21158796)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21389019
GRCz11 18 21378085
KASP Assay ID:
2261-2162.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATGGAATAATGTATTGTTTAATTTTCAGGTTAGCCTTATTTTACAATA[T/A]CTCCCAGACGTTTTTACTCTAAAAGCTGCTCCTGGAACTGTATGCCGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 3337 4812 60 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 Nonsense 858 1388 16 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21159569)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21389792
GRCz11 18 21378858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGTTACCATGACATTATCATTCTGGAGAACGTTGGCAACAGAGTTCAG[C/T]AGGAAAGCACTGAAAGTAAGTGACAATGAATTTTTCAAACATTCTAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14679
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4004 4812 71 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21170002)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21400225
GRCz11 18 21389291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCAGCTGTAGCTCCAGATCTGGAATTTTCTTCCCTCAAGCATAATTTT[G/T]GACTGCAATTCACATATTGTTCTGGTATGGTCCCTGCTACACACACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43106
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4114 4812 73 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21170492)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21400715
GRCz11 18 21389781
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTGATTTAGAGGACCCGGCACACAGAGTGGTCAATTTTGGAGCTTTG[C/T]AGATTGGCCAGCAAAGTCGGAAATTGGTTTCCCTTGTGAATAACAGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32205
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4158 4812 74 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21171898)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21402121
GRCz11 18 21391187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACAATTTTTTTTTCTCCCTTCAGATCTTGTCAGTGCGTCCAGATGGC[C/T]AGGTAACACTTAAAGAGGGAGGTGGCCGCTGTGCGGTTGAGCTTCTCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7857
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 4243 4812 None 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21174595)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21404818
GRCz11 18 21393884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTATACCATGTCAAATGTAYAGTACAAATGAACTTTTCCWCATTCTTCTC[A/T]GATTCAAATGGGATGTAAAGAGTTTTGCTCCAGATTTCACCATTTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44889
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Essential Splice Site 4316 4812 None 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1145 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21174818)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21405041
GRCz11 18 21394107
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACTCACTCTCACTGGCTCCTGCATTGTCCCACCAGTCGCACCAGAGG[T/C]AATAGACTGAAGAAAACACTGAATGCAACAGTGTCACTTTCCTTCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23295
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079297 Nonsense 4369 4812 76 81
ENSDART00000100830 None None 140 None 4
ENSDART00000136934 None None 582 None 11
ENSDART00000139351 None None 268 None 4
ENSDART00000142807 None None 161 None 2
ENSDART00000143265 None None 1388 None 24
ENSDART00000147321 None None 1146 None 21
Genomic Location (Zv9):
Chromosome 18 (position 21175136)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21405359
GRCz11 18 21394425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCGGGCCACCCACTCTCCTCACTGAGCCTACTCAACAGAACACCTA[T/A]GAGATCACATACAAGCCGCTGGTCATGACTACTGATGGGGAGAAGCATGA
Associated Phenotype:
Not determined