Busch Lab

ZMP

SLC39A8 (1 of 2)

Ensembl ID:
ENSDARG00000056757
Description:
solute carrier family 39 (zinc transporter), member 8 [Source:HGNC Symbol;Acc:20862]
Human Orthologue:
SLC39A8
Human Description:
solute carrier family 39 (zinc transporter), member 8 [Source:HGNC Symbol;Acc:20862]
Mouse Orthologue:
Slc39a8
Mouse Description:
solute carrier family 39 (metal ion transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI:1914797]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa106 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28074
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034619 Nonsense 191 393 6 11
Genomic Location (Zv9):
Chromosome 13 (position 11419101)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACACCTTCCCCAAACCCAAACCCAACCATCACAGGTATTATTGTCTA[T/A]ACCGTCCCCAAACCCAAACCCAACCATCACAGTTATTAATGTCTACACCT
Long Flanking Sequence:
TTCCCTAAACCTAAACCCAACCATCATAGTTAATAATGTCTACACCTTCCCTAAACCTAAACCCAACCATGACAGTTATTAATGTCTACACCTTCCACAAACCTAAAACCAACCATCACAGTTATTAATTTCACACCTTCCCAAAACCTAAACCCAACCATCACAGTTATTATTGTCTACACCTACCCCAAACCTAAACCCAACCATCACAGTTATTAATGTTTACACCTTCCCAAACCCCAAACCCAACCATCACAGTTATTAATGTCTACACCTTCCCCAAACCTAAACCCAACCATCACAGTTATTAATGTTTACACCTTCCCAAACCCAAACCCAACCATCACAGTTATTATTGTCTACACCTTCCCCAAACCTAAACCCAACCATCACAGTTATTATTGTCTACACCTTCCCCAAACCCAAACCCAACCATCACAGTTATTATTGTCTACACCTTCCCCAAACCCAAACCCAACCATCACAGGTATTATTGTCTA[T/A]ACCGTCCCCAAACCCAAACCCAACCATCACAGTTATTAATGTCTACACCTTCCCCAAACCTAAACCCAACCATCACAGTTTTTATTGTCTACACCTTCCCCAAACCCAAACCCAACCATCACAGTTATTAATGTCTACACCTTCCCTAAACCCAACCATCATAGTTAATAATGTCTACACCTTCCCTAAACCTAAACCCAACCATGACAGTTATTAATGTCTACACCTTCCACAAACCTAAACCCAACCATCACAGTTATTATTGTCTACACCTTCCCCAAACCCAAACCCAACCATCACAGTTATTAATGTCTACACCTTCCCCAAACCCAAACCCAACCATCACAGTTATTATTGTCTACACCTTCCCCAAACCCAAACCCAACCATCACAGTTATTAATGTTTACACCTTCCCAAACCCCAAACCCAACCATCACAGTTATTAATGTCTACACCTTCCCAAACCCAAACCCAACCATCACAGTTATTAATGTCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa106
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034619 Nonsense 289 393 10 11
Genomic Location (Zv9):
Chromosome 13 (position 11411473)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11563503
GRCz11 13 11695978
KASP Assay ID:
554-0400.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTATTCTAAGTCTCTCTTTGTCTCTGCAGGTGATTTTGTGATTCTGT[T/A]GAACTCTGGCATGAGTGTTGGTCAGGCTGCGTTTTTTAATTTGCTGTCAG
Long Flanking Sequence:
AAATCTTACACACTGTATGTTTAGGCATGGTTGCTTTTAATGTGTACATATGGGACTATAGTGAACGCTCATTTTTTGAAGTTTTCACTTGAAAGATGTCCAATCGAATACATTTTTGCATGGATGAAACAATGGAAATGCATTTAAGTGAATTGCAAAAACGCTGACAGTGTCTCTTTTGTGTGATGTTTGGACAGAATGCGTGTGCGTTATTTGCATGTCGCTGGCTGAAGGGTTCTGCGATGTCTAATATAAAGACTGTGGCGTGGATGATCACCGTCAGTGATGCTTTGCATAACTTCATAGACGGTCTGGCCATCGGAGCGTCTTTCACACTGTCTCTCCTCAGCGGCTTCAGCACCTCCATCGCCATCTTCTGTGAAGAGTTCCCTCATGAGCTGGGTAAAACACAGGCACAGAGACACAGGCACTGCATCATATTATCAGATCGTGTTATTCTAAGTCTCTCTTTGTCTCTGCAGGTGATTTTGTGATTCTGT[T/A]GAACTCTGGCATGAGTGTTGGTCAGGCTGCGTTTTTTAATTTGCTGTCAGCGATGTGCTGCTATCTCGGGCTGGCACTGGGCATCCTGCTGGGCAGTAATTTTGCTCCAAATGCTATCTTTGCCATTGCTGGTGGAATGTTCCTCTACATCTCTCTTGCAGACATGGTGAGATTTTCTTCTCATTTCACTTCTAATTGTTGTAACTTTTACAATTATTGTGTCATCCCAAAAATATAGCCATGAAAAGGTGTTTAAATAAACTCACCTATATTACACCCTAAACATTGTGCCAAACAAATCAAAATACAAAGCAGTTTGTCATAAAAAAAATCATGTCATGCCTTAAAATTGGGTTTCCGAACAAAAACCCTAGAATACCACTTTTAATCGTTTCTTTAGTGCCTAAGGAGCTTAAATATTAGCATATACCCGATTAGCCTGACAGCTTAACTCATACACATTATGAATTTACACCTTCCCTTCATTCATTGTTAAATGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461