Busch Lab

ZMP

necab2

Ensembl ID:
ENSDARG00000056745
ZFIN ID:
ZDB-GENE-050706-167
Description:
N-terminal EF-hand calcium-binding protein 2 [Source:RefSeq peptide;Acc:NP_001025366]
Human Orthologue:
NECAB2
Human Description:
N-terminal EF-hand calcium binding protein 2 [Source:HGNC Symbol;Acc:23746]
Mouse Orthologue:
Necab2
Mouse Description:
N-terminal EF-hand calcium binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2152211]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13964 Nonsense Available for shipment Available now
sa36646 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13964
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100853 Nonsense 183 269 7 9
ENSDART00000140161 Nonsense 251 428 7 13

The following transcripts of ENSDARG00000056745 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21350599)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21580822
GRCz11 18 21569888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTATGACCTAGATCTTACCCCAGTAAGACCAGCCCACGCGTCCCAGAT[C/T]GACGCTATGAGGCACCGGTGCCAGATTATCCTCCCAACAACAGAGTCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4019
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100853 Missense 258 269 9 9
ENSDART00000140161 Essential Splice Site 325 428 None 13

The following transcripts of ENSDARG00000056745 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21371682)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21601905
GRCz11 18 21590971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTGACCTACATCAGCGACTAACAGACACTGATGGCACAACTAGCGCAG[T/A]AAGTACTAAAGCACGTCTTATATACCAAAGAGCATGACNNNNAAAAAAAATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36646
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100853 Nonsense 266 269 9 9
ENSDART00000140161 None None 428 None 13

The following transcripts of ENSDARG00000056745 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 21371707)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21601930
GRCz11 18 21590996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACACTGATGGCACAACTAGCGCAGTAAGTACTAAAGCACGTCTTATATA[C/G]CAAAGAGCATGACAAAAAAAATACACCAAATCGTAAAAGACAATGCATGC
Associated Phenotype:
Not determined