Busch Lab

ZMP

tas1r1

Ensembl ID:
ENSDARG00000056739
ZFIN ID:
ZDB-GENE-060208-2
Description:
taste receptor type 1 member 1 [Source:RefSeq peptide;Acc:NP_001034614]
Human Orthologue:
TAS1R1
Human Description:
taste receptor, type 1, member 1 [Source:HGNC Symbol;Acc:14448]
Mouse Orthologue:
Tas1r1
Mouse Description:
taste receptor, type 1, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927505]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16836 Nonsense Available for shipment Available now
sa45001 Nonsense Mutation detected in F1 DNA Not yet available
sa43966 Nonsense Mutation detected in F1 DNA Not yet available
sa17292 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8008
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 241 821 3 7
ENSDART00000135440 Nonsense 237 430 3 4
Genomic Location (Zv9):
Chromosome 23 (position 21726802)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506109
GRCz11 23 21432660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATACCAAGCCCAGRWCCCTGCGGTAACAGACAGCACAAAGAAATACATG[C/T]AAGACATGGTCAAAAACATCCTCAAAACTAAAGTCAACACTATAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16836
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 291 821 3 7
ENSDART00000135440 Nonsense 287 430 3 4
Genomic Location (Zv9):
Chromosome 23 (position 21726953)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506260
GRCz11 23 21432811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACGYGACGGGTAAAGTGTGGATTGGGACAGAGGACTGGTCAGTGGCGT[C/A]GACGGYTAGTAGTATTCCAGGAATCAGYATGAWAGGGACAGTCATTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45001
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 393 821 3 7
ENSDART00000135440 Nonsense 389 430 3 4
Genomic Location (Zv9):
Chromosome 23 (position 21727260)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506567
GRCz11 23 21433118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCGCTGCACAATGTACTGGATTGTGACTCTGGACTGTGTCAGAAATA[T/A]GACGTGCAGCCATGGCAGGTTAGTGGTGATCAATATAGTATTAGACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43966
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 401 821 4 7
ENSDART00000135440 Nonsense 397 430 4 4
Genomic Location (Zv9):
Chromosome 23 (position 21727373)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506680
GRCz11 23 21433231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTGTTTGTGTTATTTGTGACACCATGTTTAAAATCCCTCAGGTTTA[T/A]GAGCAGCTGAGACAAGTGCGCTTTTCCATCCGAAATGCATCATTTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17292
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104214 Nonsense 464 821 4 7
ENSDART00000135440 None None 430 None 4
Genomic Location (Zv9):
Chromosome 23 (position 21727562)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21506869
GRCz11 23 21433420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGTCCTRGTGYCAATGATCTTCATTTAGACGACTCTCAGATTGACTG[G/A]TCAGGACAAGTGTCTCCTGTAACCAATGTAAGTTTGTATTTTTCATATTCNNN
Associated Phenotype:
Not determined